ID: 1098950545

View in Genome Browser
Species Human (GRCh38)
Location 12:76636481-76636503
Sequence GTTTTTCAGGGGGTCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098950535_1098950545 14 Left 1098950535 12:76636444-76636466 CCCTTAAATCCATCTCTCCGAGA No data
Right 1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG No data
1098950536_1098950545 13 Left 1098950536 12:76636445-76636467 CCTTAAATCCATCTCTCCGAGAA No data
Right 1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG No data
1098950537_1098950545 5 Left 1098950537 12:76636453-76636475 CCATCTCTCCGAGAAGTTTCTAG No data
Right 1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG No data
1098950538_1098950545 -3 Left 1098950538 12:76636461-76636483 CCGAGAAGTTTCTAGCTGACGTT No data
Right 1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098950545 Original CRISPR GTTTTTCAGGGGGTCATGGA GGG Intergenic
No off target data available for this crispr