ID: 1098957850

View in Genome Browser
Species Human (GRCh38)
Location 12:76705979-76706001
Sequence TAGGGGAATAAGCTTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098957850_1098957858 13 Left 1098957850 12:76705979-76706001 CCCTCATCAAGCTTATTCCCCTA No data
Right 1098957858 12:76706015-76706037 GAATCTTAGCATTCCACCCTGGG No data
1098957850_1098957857 12 Left 1098957850 12:76705979-76706001 CCCTCATCAAGCTTATTCCCCTA No data
Right 1098957857 12:76706014-76706036 AGAATCTTAGCATTCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098957850 Original CRISPR TAGGGGAATAAGCTTGATGA GGG (reversed) Intergenic
No off target data available for this crispr