ID: 1098957850 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:76705979-76706001 |
| Sequence | TAGGGGAATAAGCTTGATGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098957850_1098957858 | 13 | Left | 1098957850 | 12:76705979-76706001 | CCCTCATCAAGCTTATTCCCCTA | No data | ||
| Right | 1098957858 | 12:76706015-76706037 | GAATCTTAGCATTCCACCCTGGG | No data | ||||
| 1098957850_1098957857 | 12 | Left | 1098957850 | 12:76705979-76706001 | CCCTCATCAAGCTTATTCCCCTA | No data | ||
| Right | 1098957857 | 12:76706014-76706036 | AGAATCTTAGCATTCCACCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098957850 | Original CRISPR | TAGGGGAATAAGCTTGATGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||