ID: 1098963400

View in Genome Browser
Species Human (GRCh38)
Location 12:76762532-76762554
Sequence GAGCAGCAGTTACTCAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098963400_1098963403 7 Left 1098963400 12:76762532-76762554 CCCTCTTTGAGTAACTGCTGCTC 0: 1
1: 0
2: 2
3: 23
4: 190
Right 1098963403 12:76762562-76762584 TGTTGCTACTTTATTACTGGAGG 0: 1
1: 0
2: 2
3: 6
4: 107
1098963400_1098963402 4 Left 1098963400 12:76762532-76762554 CCCTCTTTGAGTAACTGCTGCTC 0: 1
1: 0
2: 2
3: 23
4: 190
Right 1098963402 12:76762559-76762581 TAGTGTTGCTACTTTATTACTGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098963400 Original CRISPR GAGCAGCAGTTACTCAAAGA GGG (reversed) Intergenic
901203256 1:7478533-7478555 GAGCCGCAGTTCCTTAGAGATGG + Intronic
901984303 1:13061996-13062018 GACCAGCAGCTCCTCGAAGAAGG + Exonic
901997507 1:13164774-13164796 GACCAGCAGCTCCTCGAAGAAGG - Exonic
902651081 1:17838046-17838068 GGGTAGAAGTTACTCAAGGAAGG + Intergenic
902845659 1:19108808-19108830 GAGCAGCAGTTCCTAAAATCTGG - Intronic
902909308 1:19583433-19583455 GCGCAGTAGTTATTCACAGATGG + Intergenic
905974395 1:42164496-42164518 GAGCAGGAGCTCCTCGAAGAAGG + Intronic
906535356 1:46548306-46548328 GGGCAGGAGTTTCTCAAAGATGG - Intronic
912685124 1:111756109-111756131 AAGCAGCAGTGACTCGAAGTCGG - Exonic
913598045 1:120396379-120396401 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914089284 1:144482941-144482963 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914309327 1:146451274-146451296 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914592784 1:149121863-149121885 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
918435674 1:184510451-184510473 GAGCTGCAGCTATTCAAAGGAGG + Intronic
918439017 1:184547010-184547032 GAACAGCAGTAACTAAAAAATGG + Intronic
922332573 1:224590342-224590364 GGACAGCAGTTACACAAAAAAGG - Intronic
923517519 1:234709964-234709986 GAGCAACAGTTGCTCAGAGAAGG - Intergenic
923704475 1:236332861-236332883 AACCAGTAGTCACTCAAAGAGGG - Intergenic
1063518347 10:6718602-6718624 AAGCAGTAGTGACTCAAAGAAGG + Intergenic
1063607147 10:7532833-7532855 GAGCAGCTGCTACTCAAACGTGG - Intergenic
1064455572 10:15484604-15484626 AAACAGCTGTTACTCACAGAGGG + Intergenic
1065838640 10:29681696-29681718 GGGCACCAGTTACTCAAAGATGG + Intronic
1068291191 10:55003727-55003749 TAACAGCAGTTTCTCAAAGCAGG - Intronic
1071548399 10:86546395-86546417 GAGCTGAAGTTACTCCAAGATGG - Intergenic
1071820522 10:89275416-89275438 GAGCTGCAGTTCCACAAATACGG - Intronic
1072204667 10:93192567-93192589 GAGCCACAGTTTCTGAAAGAGGG + Intergenic
1072430972 10:95370084-95370106 GAGCAGCAGAGACTCAAACCAGG - Intronic
1076945471 10:133646217-133646239 CAGCTGCAGTTACTCAAAGTGGG - Intergenic
1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG + Exonic
1078570006 11:12449541-12449563 GAGCAGCAGTAAGTCCATGAAGG - Intronic
1079638993 11:22780614-22780636 AAGCAGTAGTTACTTAAAGAAGG + Intronic
1080182777 11:29444367-29444389 GAGCAGGCATTTCTCAAAGAAGG - Intergenic
1081206824 11:40285229-40285251 GAGTAGAAGTGACTCAAAGGGGG + Intronic
1081784063 11:45733892-45733914 GAGTAGGAATTACTCAAGGAAGG - Intergenic
1081856659 11:46308210-46308232 GAGCCTCAGTTACTCCAAGGGGG - Intronic
1085361818 11:75895349-75895371 GAGAAGCAGATAAACAAAGAGGG - Intronic
1087166515 11:95009872-95009894 GAGCTTCAGTTAATCACAGAAGG - Intergenic
1088071680 11:105794000-105794022 GAGCAGTAGGCACTCACAGAAGG + Intronic
1090381844 11:126332852-126332874 GAACAGCAGAAACTCTAAGAAGG - Intronic
1090496279 11:127215749-127215771 TAGCAGCAGTTTCTGAAAGAAGG + Intergenic
1091805475 12:3353000-3353022 GAGCAGGAATTAGGCAAAGAAGG + Intergenic
1092671358 12:10865479-10865501 GAGCATACATTACTCAAAGACGG - Intronic
1094487435 12:30936176-30936198 GAGCAGGAATTAAGCAAAGAAGG - Intronic
1095357065 12:41287604-41287626 GAGCAGAAGGTCCTAAAAGAAGG - Intronic
1097909856 12:64958185-64958207 GTGCAGCAATTACACAAAGCAGG - Intergenic
1097940074 12:65294409-65294431 TAGCAGCAGTTTTTCAAAGTGGG + Intronic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1099477466 12:83124582-83124604 GAGCAGAAGTTTGTCAGAGAGGG + Intronic
1101674151 12:106902517-106902539 GAGCAAGAGTCAGTCAAAGACGG - Intergenic
1102012010 12:109624569-109624591 GAGGAGCTGTGACTCAGAGAAGG + Intergenic
1102978013 12:117220481-117220503 GAGCTCCAGTTATCCAAAGAGGG - Intronic
1103253541 12:119521619-119521641 GTGCAGCTGAAACTCAAAGAGGG + Intronic
1104147487 12:126049318-126049340 GGGCAGCTGTAACTCAAAGAAGG + Intergenic
1104377184 12:128275015-128275037 GAAGAGCTGTTACTAAAAGAAGG + Intronic
1105546546 13:21355005-21355027 GAGCTGAAGTCACTCAAGGAAGG - Intergenic
1110284688 13:73735608-73735630 GAGCAGCATTTGGTCAAAAAAGG + Intronic
1110812904 13:79830129-79830151 GAGGAGCTGTTACACAAAGTAGG + Intergenic
1114236553 14:20828742-20828764 GTGGAGCAGTTAATCGAAGAAGG + Intergenic
1116972220 14:51077795-51077817 GAGCAGCTGTTGCTGAAACAAGG - Intronic
1118398407 14:65356789-65356811 AAGCAGCAGTAACTCCCAGATGG - Intergenic
1118561733 14:67092341-67092363 GAGAAGGAGGTACTCAAAGGAGG - Intronic
1120564191 14:86034468-86034490 GAGTAGCAGTAACTCAAAAATGG + Intergenic
1202919494 14_KI270723v1_random:18020-18042 CAGCTGCAGTTACTCACAGTGGG - Intergenic
1202925133 14_KI270724v1_random:16973-16995 CAGCTGCAGTTACTCACAGTGGG + Intergenic
1124996980 15:34732898-34732920 CAGCAGCTCTTACTCATAGAAGG - Intergenic
1127568245 15:60214529-60214551 GAGCAGCAGATGCTCTAAGAGGG + Intergenic
1127870297 15:63067455-63067477 AAGCAGGATTTACTCAGAGAAGG - Intronic
1128183415 15:65624478-65624500 CAGCAGCAGGTACAGAAAGAAGG + Exonic
1131296256 15:91151911-91151933 AAACAGTAGTTACTCAAAGAAGG + Intronic
1131938076 15:97529173-97529195 GAGCAGCTGTTGCTCAGCGATGG - Intergenic
1132041960 15:98532691-98532713 GTGTAGAAGTTCCTCAAAGAAGG - Intergenic
1133340996 16:5035862-5035884 AAGGAGCAGTGGCTCAAAGAGGG - Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1136536060 16:30900215-30900237 GAGCAACAGTTATCCCAAGAGGG + Intronic
1139078176 16:63480800-63480822 GAGCACCTGTTACTCATGGATGG - Intergenic
1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG + Intergenic
1144009952 17:11137614-11137636 TAGCAGCAGTAAGTAAAAGATGG + Intergenic
1144694048 17:17289313-17289335 GAGCATCAGTTTCTGAAGGATGG - Intergenic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154389721 18:13925961-13925983 GAGCAGCATGTGCTCAGAGAGGG - Intergenic
1154394566 18:13975232-13975254 AAGCAGCAATGACTCAATGATGG + Intergenic
1154396260 18:13992662-13992684 GAGCACCAGTTACACAGAGCAGG + Intergenic
1156848983 18:41703578-41703600 AAGAAGCTGTTAATCAAAGAAGG - Intergenic
1158885972 18:61827827-61827849 CAGCTGCAGTAACTCAATGAGGG + Intronic
1158956528 18:62545414-62545436 GAGGAGCTGGAACTCAAAGAAGG - Intronic
1161835784 19:6645348-6645370 GAGCAGCATTTAACCAATGATGG - Intergenic
1165603312 19:37077735-37077757 GATCACCAGTTACTCAATTACGG + Intronic
925231712 2:2238802-2238824 GGGCAGCTTTTAGTCAAAGAGGG - Intronic
926173475 2:10568895-10568917 GAGAAGCATTTCCTCACAGATGG - Intergenic
929991923 2:46797444-46797466 GAGAAGCAATTACGCACAGATGG - Intergenic
930986572 2:57595927-57595949 GAACAGCAGTTACTAGAAGTTGG - Intergenic
932239432 2:70145292-70145314 GGACAGCAGTCACTGAAAGATGG + Intergenic
932261370 2:70330486-70330508 GAGCAGCAGTAACTTAATGCTGG - Intergenic
932882394 2:75515909-75515931 GAGCAGGATTTACTCAGAGTTGG + Intronic
937748695 2:125447538-125447560 AAGCAGCAAATATTCAAAGAAGG + Intergenic
938748666 2:134307187-134307209 AAGCTGCTGTTAATCAAAGAAGG + Intronic
939779736 2:146430961-146430983 AAGAAGCTTTTACTCAAAGAGGG - Intergenic
941656363 2:168148931-168148953 GAGGACCTGTTGCTCAAAGAAGG - Intronic
942366498 2:175233812-175233834 GAGCAGAAATAACTCACAGAAGG - Intergenic
942398479 2:175576803-175576825 AAGAAGCAGTTACTCAAACTGGG - Intergenic
942748269 2:179260939-179260961 CAACAGCAGTTTCTCCAAGATGG + Intronic
942938889 2:181593040-181593062 AAGCAGCAGGTACTCAATAAAGG - Intronic
947979548 2:234397500-234397522 GAGCAGCATTTACTCAAAAGAGG + Intergenic
948042566 2:234914912-234914934 GAGTAGCTGTCCCTCAAAGAGGG - Intergenic
1169249123 20:4046687-4046709 GAGCAGCTGTGTCTCAGAGAGGG - Intergenic
1171783457 20:29442311-29442333 CAGCTGCAGTTACTCACAGTGGG - Intergenic
1173354952 20:42278606-42278628 GGGCATCAGTTTCTCAAAGGGGG + Intronic
1173837818 20:46137272-46137294 TAGAAGCAGTGACTCAAATAGGG - Intergenic
1174125259 20:48299749-48299771 GAGATGCAGATACTGAAAGATGG + Intergenic
1177262517 21:18749299-18749321 GAGCAGCAGGAAGGCAAAGAGGG + Intergenic
1177442216 21:21140876-21140898 GTGTAGCAGTTACTCTAAGAAGG + Intronic
1177521505 21:22233800-22233822 GAACAGAATTTACACAAAGATGG - Intergenic
1178123767 21:29495821-29495843 ACGCAGCAGGTACTCAGAGATGG - Intronic
1185354423 22:50358676-50358698 GATCAGCAGTTGCTTAGAGAAGG - Intronic
949102047 3:157346-157368 GAGCTGTAGCTACACAAAGATGG + Intergenic
951362161 3:21738175-21738197 GAGCAGCAGTTGTTTGAAGAAGG - Intronic
953164380 3:40451934-40451956 AAGCAGTAGTCACTCAAAGAGGG - Intergenic
953700291 3:45190413-45190435 CAGCAGCAATTCTTCAAAGATGG - Intergenic
953951040 3:47190427-47190449 GAACAGCAGTTAACCAAAGCAGG + Intergenic
955253883 3:57309750-57309772 GAGGAGCAAGGACTCAAAGAGGG + Intronic
956446658 3:69332408-69332430 AAGAAGCAGCTACTCAGAGAGGG + Intronic
956760020 3:72433544-72433566 GAGCTGCTGTTACTCAAACTTGG + Intronic
957082013 3:75644251-75644273 CAGCTGCAGTTACTCACAGTGGG + Intergenic
958451365 3:94277468-94277490 GGTCAGCACTTACTCAGAGAGGG - Intergenic
958888813 3:99760265-99760287 GACCAGGAATTCCTCAAAGATGG - Intronic
961076637 3:123988846-123988868 GAAAATCAGTGACTCAAAGAAGG + Intronic
961524152 3:127485993-127486015 GGGCAGCAGCTACTGAAATAAGG + Intergenic
964876678 3:161375348-161375370 GAAGAGAAGTTACTAAAAGATGG - Intergenic
965960481 3:174423238-174423260 GAGCACCAGTTGCCCAATGAAGG + Intergenic
967085182 3:186088455-186088477 GAGGAGCAGTGACCCAAAGCTGG - Intronic
967417929 3:189239610-189239632 GGGCAGGAGTTAGCCAAAGAAGG + Intronic
968187760 3:196644908-196644930 GTGCAGTAGTTATTCACAGATGG - Intronic
968576024 4:1366530-1366552 AAGCAGCAGTTACCACAAGATGG - Intronic
972138773 4:35928610-35928632 AAGCAGCATTTAGTCAAAGTGGG + Intergenic
972171380 4:36349761-36349783 AAGCAGCAGTCACTCAAAGAAGG - Intergenic
972404866 4:38735928-38735950 GAGGAACAGTTCCCCAAAGAAGG - Intergenic
972973681 4:44607570-44607592 GAGCAGCACTTGCTGAAAGTAGG - Intergenic
973874202 4:55199101-55199123 GATCTACAGTTACTCCAAGACGG + Intergenic
974107031 4:57481353-57481375 GAACAGCAGTTACCAGAAGATGG + Intergenic
978535850 4:109761671-109761693 GAGGTGCTGATACTCAAAGAAGG - Exonic
978610646 4:110535005-110535027 TAGCAGCTGATACTAAAAGATGG - Intronic
979098240 4:116578147-116578169 CAGCAATAGTTAGTCAAAGATGG + Intergenic
980280840 4:130717332-130717354 CAGCAGCAGCCAATCAAAGAAGG + Intergenic
982698815 4:158635754-158635776 GAGCCACAGTTACAGAAAGAAGG - Intronic
983264067 4:165488826-165488848 GAGCAGCCTTTATTCAAAGGAGG - Intronic
983518685 4:168683966-168683988 AAGTATCAGTTACTCAGAGATGG + Intronic
984035744 4:174665281-174665303 GAACAGTAGTTACCCAAAGAAGG - Intronic
985448857 4:190046729-190046751 CAGCTGCAGTTACTCACAGTGGG - Intergenic
987723585 5:21668552-21668574 GAGCAGCTGTTTCTCAGAGAAGG + Intergenic
987951848 5:24686699-24686721 GAACTGCAGCTCCTCAAAGAAGG + Intergenic
987963407 5:24840074-24840096 CGGAAGCAGTTTCTCAAAGATGG + Intergenic
990172415 5:53068013-53068035 AAGCAGCAGTTAATGAAAGAAGG - Intronic
991071197 5:62482609-62482631 GATCAGGAGTTACACAATGATGG + Intronic
991911347 5:71564763-71564785 GATCAGCCCTTACTGAAAGAAGG + Exonic
995043292 5:107614586-107614608 GAGTTGCAGGTACTCAAAGATGG - Intronic
996350234 5:122532256-122532278 GAGGATCAGTTACTCACAGGGGG + Intergenic
997637822 5:135427636-135427658 GAGAAGCAGAGACTCTAAGAAGG - Intergenic
997924720 5:138019071-138019093 GAGTTGCAGTTACTCAAGGAAGG + Exonic
998036796 5:138924219-138924241 GAACAGCTGTGTCTCAAAGATGG + Intronic
1000478112 5:161737563-161737585 AAGCAGCAGATACTAAAACAAGG + Intergenic
1000974542 5:167750550-167750572 TAGAAGCAGTTAATCAAGGACGG + Intronic
1001222048 5:169909064-169909086 CAGCAGCAGCTACTGAAAGCAGG - Intronic
1002198267 5:177512817-177512839 GAGCAGCAGGTACTCGTGGATGG + Exonic
1003405150 6:5821757-5821779 GAGCTGAAGTCACTCAAGGAAGG + Intergenic
1004971757 6:20918184-20918206 GAGCACCTGTTCCTCATAGATGG - Intronic
1005681740 6:28215643-28215665 AGGCAGCAATTGCTCAAAGAGGG + Intergenic
1007596770 6:43055718-43055740 TAGGAGCAGATACACAAAGAAGG + Intronic
1008056713 6:46953134-46953156 GAGAAGCATTCACTTAAAGAAGG - Intronic
1008334241 6:50281230-50281252 CAGAAGAAGTTACTGAAAGAAGG - Intergenic
1008690537 6:53973702-53973724 GAGCATCACTTCCTCAATGAAGG - Intronic
1008696844 6:54048415-54048437 GAGCAGAGGTTATTCAGAGATGG + Intronic
1012305019 6:97644681-97644703 TAGTAGCAGAAACTCAAAGAGGG - Intergenic
1014798470 6:125750576-125750598 CTGCAGCTGTCACTCAAAGAGGG + Intronic
1015353250 6:132247351-132247373 TGGCAGCAGTCACTCAAAGGAGG - Intergenic
1019118322 6:169783583-169783605 GAGAAGCAGTGATTCACAGAGGG - Intergenic
1020244042 7:6416970-6416992 GCCCAGCAGAGACTCAAAGATGG + Intronic
1027558706 7:79699451-79699473 GAGGAGCAGTTAAGCACAGAAGG - Intergenic
1028866553 7:95720282-95720304 GAGCAGCCATTACTCTCAGAAGG + Intergenic
1031717917 7:125131907-125131929 GAGCAGGAGGTACTCAAGGAAGG + Intergenic
1032219400 7:129982611-129982633 GAGCAGAAAAGACTCAAAGACGG + Intergenic
1035470776 7:159107363-159107385 GAACAGCAGCTGCTCACAGAAGG + Intronic
1037305040 8:17496485-17496507 GAGCAGAAGTTACACAATCAGGG - Intergenic
1037480367 8:19299619-19299641 AAGCAGCAGTGATTCATAGAGGG + Intergenic
1038603679 8:28975923-28975945 GAGTAGCAGGTCCTTAAAGAAGG + Intronic
1038927423 8:32156153-32156175 GAGGAGGAGGAACTCAAAGAGGG - Intronic
1040097799 8:43464176-43464198 GAGAAGCACTTTCTTAAAGAAGG + Intergenic
1040388053 8:46927022-46927044 GAGCAGCAGGTTCTTAGAGAAGG - Intergenic
1041258640 8:56001095-56001117 CAGCAGCAGGGACTCACAGAGGG + Intronic
1042964908 8:74339909-74339931 GATCATCAGTTATTTAAAGAGGG + Intronic
1044834958 8:96286795-96286817 TAGCATCAGTTTCTCAGAGATGG + Intronic
1047461887 8:125073260-125073282 GTGCAGCAATTTCTAAAAGAAGG - Exonic
1049917840 9:335858-335880 GATAAGAAGATACTCAAAGACGG + Intronic
1050415747 9:5415159-5415181 AAGAAGCAGGTACTCAAAAAAGG + Intronic
1051153763 9:14116518-14116540 GAGCAGCAGCATTTCAAAGAAGG + Intronic
1053653373 9:40191662-40191684 GAGCAGCAGGTCTCCAAAGAAGG - Intergenic
1054531211 9:66184556-66184578 GAGCAGCAGGTCTCCAAAGAAGG + Intergenic
1055207809 9:73753487-73753509 GAGTAGCAGTTACTACAGGATGG + Intergenic
1055379150 9:75687313-75687335 GAGCAGAATTTATTCAAACATGG + Intergenic
1056922563 9:90804328-90804350 GAGCAGAAGTTACTTACAGGAGG + Intronic
1059295819 9:113269442-113269464 AAACAGCAGTTGCTCAAAGTGGG - Intronic
1059426760 9:114226036-114226058 GGGTTTCAGTTACTCAAAGAGGG - Intronic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1059709965 9:116858444-116858466 GGGCAGCAGTTACTTAGAGATGG + Intronic
1060268319 9:122125109-122125131 GAGCAGAACTTGCTCACAGAAGG - Intergenic
1186586069 X:10874348-10874370 CAGCAGCAGGTACTGAAACATGG + Intergenic
1187041496 X:15600860-15600882 GAGCAGCAGTTACAGCAACAAGG + Exonic
1187529170 X:20080942-20080964 GAGAAGCGGTTGCTCAATGAGGG + Intronic
1189548233 X:42066201-42066223 GTGGAGCAGTTTCTCAGAGAAGG - Intergenic
1191007734 X:55728281-55728303 GAGCAGCAGTTACTCAGCTCTGG - Intronic
1193124139 X:77853260-77853282 AAACAGTAATTACTCAAAGATGG - Intronic
1195511992 X:105726611-105726633 AAGCAGTAGTCACTCAAAGGAGG - Intronic
1196492509 X:116284893-116284915 GAGTAGCGGTTGTTCAAAGATGG - Intergenic
1196573554 X:117291631-117291653 GAGCAGAAATTAATGAAAGAAGG + Intergenic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1200873854 Y:8131726-8131748 GAGCTGCTGTTGCTCCAAGAAGG - Intergenic