ID: 1098965344

View in Genome Browser
Species Human (GRCh38)
Location 12:76782287-76782309
Sequence CTCAGGTAACATTCCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098965344_1098965349 -1 Left 1098965344 12:76782287-76782309 CCCTCCCTGGAATGTTACCTGAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1098965349 12:76782309-76782331 GTAAAGTGTTAGAGAATTCTTGG 0: 1
1: 0
2: 1
3: 17
4: 240
1098965344_1098965352 16 Left 1098965344 12:76782287-76782309 CCCTCCCTGGAATGTTACCTGAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1098965352 12:76782326-76782348 TCTTGGGAAAAGTATGATTTGGG 0: 1
1: 0
2: 2
3: 33
4: 540
1098965344_1098965353 24 Left 1098965344 12:76782287-76782309 CCCTCCCTGGAATGTTACCTGAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1098965353 12:76782334-76782356 AAAGTATGATTTGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 18
4: 156
1098965344_1098965350 0 Left 1098965344 12:76782287-76782309 CCCTCCCTGGAATGTTACCTGAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1098965350 12:76782310-76782332 TAAAGTGTTAGAGAATTCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 289
1098965344_1098965351 15 Left 1098965344 12:76782287-76782309 CCCTCCCTGGAATGTTACCTGAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1098965351 12:76782325-76782347 TTCTTGGGAAAAGTATGATTTGG 0: 1
1: 0
2: 1
3: 29
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098965344 Original CRISPR CTCAGGTAACATTCCAGGGA GGG (reversed) Intronic
900721237 1:4177096-4177118 CGCAGGGAACACTCAAGGGAAGG + Intergenic
902803326 1:18845055-18845077 CTCTGGGAAAATTCCAGGAAGGG + Intronic
904005074 1:27359343-27359365 CTCTTGGAACTTTCCAGGGAAGG - Intronic
908341789 1:63188518-63188540 CTCACGTAACAGTCCAGTGAAGG + Intergenic
909170964 1:72294921-72294943 CTCTGGTATCTTTCCAGGGATGG + Intergenic
909179530 1:72404542-72404564 CTCAGGAAACAGGCCAGGCACGG + Intergenic
910439221 1:87235056-87235078 CTCTGGTAAAATACCAGGAAAGG + Intergenic
911749692 1:101482087-101482109 CTAAGGCAAGATTACAGGGAGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915941986 1:160124052-160124074 CTCAGGTAAGATGGCAGGGCTGG + Exonic
916986405 1:170196823-170196845 CTCTGCTCACATTCCAGAGAGGG - Intergenic
917578381 1:176348471-176348493 CAAAGGTAACATTCTAAGGATGG + Intergenic
917656134 1:177127612-177127634 CTCAGGTCACCTTCCATTGAAGG - Intronic
918091628 1:181300144-181300166 CTAAGGGAACAGTGCAGGGATGG + Intergenic
918108469 1:181434050-181434072 CTCATCTTAGATTCCAGGGATGG - Intronic
918513155 1:185333506-185333528 ATCAGGGAAGATTCCAGAGAAGG + Intergenic
919604561 1:199665619-199665641 CTCTGCAAACATTCAAGGGATGG + Intergenic
921283504 1:213589078-213589100 CTCAGGTGACTCACCAGGGAGGG - Intergenic
1063998030 10:11639732-11639754 CCCAGGTGACATTTCAGGGGAGG - Intergenic
1065900394 10:30201839-30201861 TTCATGTAACAGTCCAGTGAGGG + Intergenic
1067540265 10:47145680-47145702 CCCAGGTATCATGCTAGGGATGG - Intergenic
1069087832 10:64162019-64162041 CTGAGGTAACATTCAAGGTCAGG - Intergenic
1069332905 10:67314364-67314386 CTCAGGTAACATTAAAGCCATGG + Intronic
1070387545 10:75939545-75939567 CTCAGGGAAGATTCCCAGGAAGG - Intronic
1074230079 10:111524839-111524861 CACAGGTAACCTCGCAGGGAGGG - Intergenic
1075210984 10:120490806-120490828 CTCAGATGACATTACAAGGAAGG + Intronic
1075212150 10:120500483-120500505 CTCAGTCTAGATTCCAGGGAGGG - Intronic
1075439376 10:122467304-122467326 GTCAGGTAACACCCCAGGAAGGG - Intronic
1076546478 10:131248916-131248938 CTAGGGCACCATTCCAGGGATGG - Intronic
1077252736 11:1567742-1567764 CTCAGATAACGTTCCTGGGCTGG + Intronic
1077825963 11:5808575-5808597 CTCAGTTACGATTCCAGTGAAGG - Intronic
1079106480 11:17575393-17575415 CTCAAGTAACACACCAGGAATGG - Intronic
1079192334 11:18290261-18290283 CTCATGTAACAGTCCAGGACAGG - Intronic
1083007680 11:59363690-59363712 CTTAGATAACAATCCAGGGCAGG + Intergenic
1083655480 11:64227128-64227150 CTCAGGTGAGATTCCAGGCTGGG + Exonic
1084413901 11:69019417-69019439 CCCAAGAAACATTACAGGGAAGG + Intergenic
1085293669 11:75418140-75418162 CTCTGCTTTCATTCCAGGGATGG + Intronic
1085298580 11:75445049-75445071 TTCACGTAACAGTCCAGGGAGGG - Intronic
1085669570 11:78450080-78450102 CTCAGGTCACATTAATGGGACGG + Intronic
1087686431 11:101270956-101270978 TTCATGAAACATTCTAGGGAGGG - Intergenic
1088540201 11:110905467-110905489 CACAGGTAACATTTTAGGAAAGG + Intergenic
1088648609 11:111937773-111937795 CTCAGGTAAGCTACCAGGGAAGG - Intronic
1088984116 11:114890367-114890389 CTGAGGTGACATTCGAGGAAGGG + Intergenic
1089171213 11:116512894-116512916 CACAGGCCACATTCCAGGCAGGG + Intergenic
1091058956 11:132444109-132444131 CCCAGGTATCAGGCCAGGGAGGG + Intronic
1092054604 12:5498433-5498455 CTCAGTTGACAAACCAGGGAAGG + Intronic
1093634578 12:21449687-21449709 CTCAGGTAACATTTTAAGGTTGG + Exonic
1093641314 12:21529525-21529547 CTCTTGAAACTTTCCAGGGATGG + Intronic
1094230172 12:28093491-28093513 CTCATGTAACAGTCCAGAGGTGG - Intergenic
1095285064 12:40401055-40401077 CTCAGGGAACCTTCCAGGTCTGG + Intronic
1095296690 12:40535062-40535084 CTCAGGTAAAACACCAGGGTGGG + Intronic
1098965344 12:76782287-76782309 CTCAGGTAACATTCCAGGGAGGG - Intronic
1101940403 12:109095600-109095622 CTCAGGTTACATTTCGGGGATGG + Intergenic
1102723880 12:115041527-115041549 ATCAAGAAACATTTCAGGGAGGG - Intergenic
1105463729 13:20617391-20617413 CTCAGTTAACATCTCAGAGATGG - Intronic
1106249591 13:27973415-27973437 CTCAGCTAACATCTCTGGGAAGG + Intergenic
1106872747 13:34039144-34039166 CCCAGGTAACCTTCCGAGGATGG + Intergenic
1107813061 13:44218795-44218817 CTCAAGTTCCATTCCAGGCAGGG - Intergenic
1110823178 13:79940222-79940244 CTCAGGAAACATACCACAGAGGG - Intergenic
1111920084 13:94401275-94401297 CTCAGTTAACATTCTTGAGAAGG + Intronic
1113942016 13:114023311-114023333 CTCAGGGAACATCCCAGGCTCGG + Intronic
1115787890 14:36846817-36846839 CTCAGTTTGCATTCCATGGAAGG + Intronic
1116622267 14:47221202-47221224 CAGAGGTAACATTGTAGGGATGG + Intronic
1116956849 14:50932757-50932779 CTCAGCTTAAATTCCTGGGAGGG - Intronic
1121290692 14:92772554-92772576 CACAGATAATTTTCCAGGGAGGG + Intergenic
1121780004 14:96616203-96616225 CCAATGTCACATTCCAGGGAAGG + Intergenic
1123831715 15:24145987-24146009 CTCATGTAACATTGTAGAGACGG + Intergenic
1123845912 15:24301776-24301798 CTCATGTAACATTATAGAGACGG + Intergenic
1123864950 15:24509486-24509508 CTCATGTAACATTATAGAGATGG + Intergenic
1125110370 15:36025529-36025551 CTCAGGTAACAATTCAGAGATGG + Intergenic
1125587174 15:40829017-40829039 CTCAGGTCCCATTCCAGAGCTGG - Intergenic
1126800348 15:52292418-52292440 CTAAGGTAACATACAAGTGATGG - Intronic
1131016209 15:89059658-89059680 CGCAGGTGCCATTCCAGAGATGG + Intergenic
1131279862 15:91012266-91012288 TTCAGGTGACATTCAAAGGAAGG + Intronic
1131363919 15:91821264-91821286 CTCAGGTACCCTTACAGAGAGGG + Intergenic
1135503170 16:23014616-23014638 CTCATGTAACATCCCATAGATGG + Intergenic
1138181725 16:54945093-54945115 CTCAGGTAACGTCGCAGTGAAGG + Intergenic
1139409828 16:66750773-66750795 CTCAGGTAACCTAGCAGTGAGGG + Intronic
1139470834 16:67177355-67177377 CCCAGGTCAGATTCCCGGGAGGG + Intronic
1141295792 16:82767864-82767886 CTCACTTAGCTTTCCAGGGAGGG + Intronic
1147648004 17:42045414-42045436 CTCAGTTCACATTCCAGAAATGG - Intronic
1149248214 17:54736771-54736793 CCCAGGCAACATTCTAAGGAAGG + Intergenic
1151847169 17:76664698-76664720 GTCAGGACACATTCCAGGGTAGG + Intergenic
1152780537 17:82225802-82225824 CCCAGGGAACCTTCCAGGGTCGG - Intergenic
1153361569 18:4203660-4203682 CTCAGGAAATGTTTCAGGGAGGG - Intronic
1153554473 18:6296686-6296708 CTCCAGTAACATTCTAGGGAAGG + Intronic
1155837194 18:30600640-30600662 TTCACTTAACAGTCCAGGGATGG - Intergenic
1156127097 18:33919335-33919357 CTCAGGTAAAAATTGAGGGAAGG + Intronic
1157411075 18:47464081-47464103 GCCAGGCAACATTCCAGGCATGG - Intergenic
1160122608 18:76144146-76144168 ATCAGGTCACATTCCCAGGATGG - Intergenic
1160489523 18:79325589-79325611 CTGAGGTCACATGACAGGGAAGG + Intronic
1160688328 19:447983-448005 CCCAGATCACGTTCCAGGGAAGG + Intronic
1161441542 19:4294561-4294583 CTCAGGTAACAGCCCAGGTAAGG - Exonic
1163786832 19:19279139-19279161 TCCAGGTAACCTTCCAGGGCAGG + Intronic
1164803129 19:31094059-31094081 CCCAGGGTACAATCCAGGGATGG - Intergenic
1167399904 19:49258176-49258198 CTAAGGTTACATTCCAGGAGAGG + Intergenic
1168481385 19:56723168-56723190 CTGAGCTTACATTCCAGGCAAGG - Intergenic
928187161 2:29121894-29121916 CTCATTTCACATTCCAGGGAAGG - Intronic
929896968 2:45969112-45969134 CTCCAACAACATTCCAGGGATGG - Intronic
933997639 2:87681440-87681462 TTCAGCTAACATCCCAGGGATGG - Intergenic
935873825 2:107484513-107484535 TTCAGGTTACATTTCAGGGAGGG - Intergenic
935913979 2:107928784-107928806 CTCAGGTCACATTGGATGGAAGG + Intergenic
936296213 2:111269430-111269452 TTCAGCTAACATCCCAGGGATGG + Intergenic
937256450 2:120559334-120559356 CTCAGGAAACAGTGCAGGGTTGG + Intergenic
938129858 2:128705239-128705261 CTCAGGTAAGATTCCCTGGTTGG + Intergenic
940422406 2:153495892-153495914 CTGAGGTAACCTTACAGGAAAGG + Intergenic
941601687 2:167550900-167550922 CTTATGTTACAGTCCAGGGAGGG + Intergenic
941638946 2:167967026-167967048 CTCAGCTCACGTTCCAGGTAAGG - Intronic
942594609 2:177581040-177581062 CTCAGGTGACATTCCAGGACAGG + Intergenic
943433905 2:187839272-187839294 TTCAGATAAAATTTCAGGGAGGG - Intergenic
945585137 2:211651914-211651936 CACAGGTAAAATTACAGGCATGG - Intronic
945903572 2:215566045-215566067 CTAAGGTCACATTCCAAGGGAGG - Intergenic
947443487 2:230143667-230143689 CTCAAGTATCTTTCCAGGGAAGG + Intergenic
1168960637 20:1866999-1867021 CTCAGGTCACAGTCCAGTGTAGG - Intergenic
1170904729 20:20503153-20503175 ATCAGGTAATATTCACGGGAGGG + Intronic
1172035144 20:32005334-32005356 TTCAGGTAACAGTCAAGGGTGGG - Intergenic
1172165288 20:32895055-32895077 CTCAGGTTCCCTCCCAGGGATGG - Intronic
1173931739 20:46826546-46826568 CCCAGGGAGCATTTCAGGGATGG + Intergenic
1174123640 20:48286912-48286934 CACAGGTGACATTTAAGGGATGG - Intergenic
1175804458 20:61819877-61819899 CTCAGGTACCAGACCAGGCAAGG + Intronic
1176361553 21:6000868-6000890 CTCTTGTAATATTCCTGGGAAGG + Intergenic
1178579027 21:33821527-33821549 CTCAGGAAACATTCCACAGAGGG - Intronic
1179761965 21:43537682-43537704 CTCTTGTAATATTCCTGGGAAGG - Intronic
1181009452 22:20032018-20032040 CCCAGGTCACATGGCAGGGATGG - Intronic
1181588350 22:23866943-23866965 CTGAGGCAACCTCCCAGGGAGGG + Intronic
1184974288 22:48050018-48050040 CCCAGAGAACATTCCAGGGTGGG + Intergenic
950736583 3:15013878-15013900 CCCAAGGAACCTTCCAGGGATGG - Intronic
954831908 3:53428069-53428091 CTCAGGTAAGAGTCCAGGAGTGG + Intergenic
954905501 3:54059048-54059070 CTCAGCTAACATTTGAAGGATGG - Intergenic
955066880 3:55541108-55541130 CTCAGATAGCATTTCAGGAATGG - Intronic
955675423 3:61443245-61443267 CTCATGTAACAGTTCAGGCATGG - Intergenic
955953856 3:64268083-64268105 GGCAGGTAACATTCCTGGGGCGG + Intronic
956113299 3:65892993-65893015 CCCAGGTAACACACCAGAGAAGG + Intronic
961108136 3:124259721-124259743 CTGAGGTTACTTTCCAGTGAGGG + Intronic
961513707 3:127420060-127420082 CTCTGGTAACATACCAGCCAAGG + Intergenic
961587747 3:127947878-127947900 ATGAGCTAACATTCCAGAGAGGG - Intronic
963246746 3:143071078-143071100 CTCAGGCAAAACTGCAGGGAAGG - Intergenic
964442255 3:156724269-156724291 CTTAGGAAACATTTCAGGAAAGG - Intergenic
967172437 3:186832333-186832355 CTCAGGTAACATGCTTTGGATGG + Intergenic
967733883 3:192932052-192932074 CTCAGGTACCAATTCAGAGAGGG - Intergenic
978062220 4:104352121-104352143 CTGGGGTAACCCTCCAGGGAAGG - Intergenic
978073362 4:104498061-104498083 CTCATGTAACAGTCCAGGGTGGG + Intergenic
978085161 4:104643029-104643051 CTCAGGCAACATGACAAGGAGGG - Intergenic
978295163 4:107196453-107196475 GTCTGGGGACATTCCAGGGAGGG - Intronic
980174158 4:129324740-129324762 CCAAGGTAACCTTGCAGGGAGGG + Intergenic
982030383 4:151294676-151294698 ACCAGGTACCATTCCAGGCATGG + Intronic
984764387 4:183388427-183388449 TTCAGGTAACATGACAGAGATGG + Intergenic
990513065 5:56506750-56506772 CCAAGGTCACATTCCAGAGAAGG - Intergenic
993101092 5:83540688-83540710 CTCAGGTAGAATTTCAAGGATGG - Exonic
993706994 5:91182463-91182485 TCCAGGTGACAGTCCAGGGAGGG + Intergenic
995461208 5:112405153-112405175 CTCGGGTCACTTTCCATGGAGGG + Intronic
996026288 5:118649761-118649783 CTCTGTAAACATTCCAGGCAAGG + Intergenic
999397784 5:151241247-151241269 CTCAGGTTACACACCAGGGTGGG - Intronic
1000732739 5:164856335-164856357 TTCAGGTTAAGTTCCAGGGAAGG + Intergenic
1002305313 5:178279561-178279583 CTCAGGTTCCAGCCCAGGGAGGG + Intronic
1003163048 6:3652229-3652251 CTCAGGCAAGAGTCCAGGGCAGG - Intergenic
1003378819 6:5603957-5603979 CTATGGTACCATTCCAAGGAGGG + Intronic
1004260184 6:14101154-14101176 CCCTGGTAACCTTCCAGGGTTGG + Intergenic
1006405430 6:33842293-33842315 ACCAGGTCACATGCCAGGGAAGG - Intergenic
1009922389 6:70078573-70078595 CTAAGGTAACCCTCCAGGAATGG + Intronic
1012227963 6:96726529-96726551 CTCATGTAACAGTGCAGTGAGGG + Intergenic
1015166510 6:130205821-130205843 CTCTGGTGACATTCCAGGCCAGG - Intronic
1015770847 6:136766650-136766672 TTAAGGTAACATTTCAGAGAAGG + Intronic
1016856326 6:148674094-148674116 CTGAGGGAACATGCCAGAGAAGG + Intergenic
1017038244 6:150286352-150286374 CTCAAATAACATCCAAGGGAAGG + Intergenic
1017517877 6:155174001-155174023 CTCAGGGAACATTCCCCAGAAGG - Intronic
1017873649 6:158505983-158506005 CACAGGTAACTTTTCACGGATGG + Intronic
1025073886 7:55925866-55925888 TTCAGGTAAATTTCCAGGGCAGG + Intronic
1028010909 7:85642578-85642600 CTCAGGTATCATGGCAAGGAAGG - Intergenic
1033476707 7:141699748-141699770 ATGAGGGAACATACCAGGGATGG - Intronic
1033890608 7:146008461-146008483 ACCAGGTAAAAATCCAGGGAGGG + Intergenic
1037549152 8:19952767-19952789 CTCAGGAAACATTCAGTGGAAGG - Intronic
1037950232 8:23014774-23014796 CTCAGGTATCATGGCAGGGGAGG + Exonic
1038104713 8:24419641-24419663 CTCAGGGAAAAAGCCAGGGATGG - Intergenic
1042190707 8:66184055-66184077 CTCCGGTAACTTTCTAGGAAAGG + Intergenic
1042770436 8:72374827-72374849 CTGGGGTAATCTTCCAGGGAGGG - Intergenic
1042844430 8:73156145-73156167 CTTAGGGAAGATTCCTGGGAGGG - Intergenic
1043358129 8:79438078-79438100 CTAAGGTCAAATTCCAGGGCTGG - Intergenic
1043625884 8:82257898-82257920 CTCTGGTGACATTTCAAGGAAGG - Intergenic
1044752516 8:95430056-95430078 CTCATGAAACAGTCCAAGGAAGG + Intergenic
1045438086 8:102184731-102184753 TTCAAGAAACATTCCAGGCAAGG - Intergenic
1047228598 8:122977054-122977076 CTCAGGCAACAGTCCAGGGTGGG + Intergenic
1048940301 8:139394805-139394827 TTTAGTTAACATTCCAGGCAGGG - Intergenic
1050273640 9:3973240-3973262 CTCAGGTGACCTTCCCTGGATGG - Intronic
1050978219 9:11969459-11969481 CACAAGTACCATTCCAGGTAAGG + Intergenic
1053262527 9:36681416-36681438 CTTAGGTAACTATCCAGGAATGG + Intergenic
1055500817 9:76900787-76900809 CTCAGGTAACATTCACGGAGGGG + Intronic
1055808475 9:80123739-80123761 CACTGGTAATATTCCAGGCATGG - Intergenic
1056767817 9:89455501-89455523 CTCAGGGGACAGTCCAGGCAGGG + Intronic
1057143969 9:92746116-92746138 CACAGGTAACCTTCTAGGGAGGG - Intronic
1059804182 9:117780911-117780933 CTCAGGTAAAATCACAGCGATGG + Intergenic
1059837853 9:118177407-118177429 CTCATATAACATTCTAGGGGTGG + Intergenic
1186798427 X:13068664-13068686 GTCAGGCCACATTCCAGGGGAGG - Intergenic
1187217416 X:17290531-17290553 CTCAAGTAACCTTACAGAGAGGG - Intergenic
1187250837 X:17596756-17596778 TTCATGTCACATTCCAGGCATGG + Intronic
1188184152 X:27092750-27092772 CTCCTGTAGCATTCCAGGGAGGG - Intergenic
1189221057 X:39372353-39372375 CTCTGCTAACATTCCAGGAGAGG - Intergenic
1189402691 X:40687071-40687093 CTCAGGTAACAGATCTGGGAAGG - Intronic
1194881996 X:99264859-99264881 CTCAAGTAGAATTCCAGAGAGGG + Intergenic
1196054057 X:111336069-111336091 CTCTGGTGACTTTGCAGGGAAGG - Intronic
1199635661 X:149809231-149809253 CTCATGTAACAGGACAGGGAAGG - Intergenic
1199943799 X:152649823-152649845 CTCAGTTCACTTTCCTGGGAAGG + Exonic