ID: 1098975170

View in Genome Browser
Species Human (GRCh38)
Location 12:76895132-76895154
Sequence CTGTATCTGCAAAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098975167_1098975170 13 Left 1098975167 12:76895096-76895118 CCTTCAGGCAAAAGCAAAATGAT No data
Right 1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098975170 Original CRISPR CTGTATCTGCAAAAGGAGCA AGG Intergenic
No off target data available for this crispr