ID: 1098977628

View in Genome Browser
Species Human (GRCh38)
Location 12:76919829-76919851
Sequence TGGTGGTGGTGAGCCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098977622_1098977628 -6 Left 1098977622 12:76919812-76919834 CCTGCTGCCCGCCGGGCTGGTGG No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data
1098977618_1098977628 3 Left 1098977618 12:76919803-76919825 CCGTGCATGCCTGCTGCCCGCCG No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data
1098977614_1098977628 26 Left 1098977614 12:76919780-76919802 CCCTGGACTTCCCAGAGGGACTG No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data
1098977612_1098977628 28 Left 1098977612 12:76919778-76919800 CCCCCTGGACTTCCCAGAGGGAC No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data
1098977617_1098977628 15 Left 1098977617 12:76919791-76919813 CCAGAGGGACTGCCGTGCATGCC No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data
1098977615_1098977628 25 Left 1098977615 12:76919781-76919803 CCTGGACTTCCCAGAGGGACTGC No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data
1098977616_1098977628 16 Left 1098977616 12:76919790-76919812 CCCAGAGGGACTGCCGTGCATGC No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data
1098977613_1098977628 27 Left 1098977613 12:76919779-76919801 CCCCTGGACTTCCCAGAGGGACT No data
Right 1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098977628 Original CRISPR TGGTGGTGGTGAGCCCTTTG TGG Intergenic
No off target data available for this crispr