ID: 1098979110

View in Genome Browser
Species Human (GRCh38)
Location 12:76935937-76935959
Sequence TTGGCCAGACAAGACCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098979110_1098979115 30 Left 1098979110 12:76935937-76935959 CCTAGATGGTCTTGTCTGGCCAA No data
Right 1098979115 12:76935990-76936012 AGTAACCATTTATTGTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098979110 Original CRISPR TTGGCCAGACAAGACCATCT AGG (reversed) Intergenic
No off target data available for this crispr