ID: 1098979115

View in Genome Browser
Species Human (GRCh38)
Location 12:76935990-76936012
Sequence AGTAACCATTTATTGTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098979112_1098979115 1 Left 1098979112 12:76935966-76935988 CCATAAGTTTATTGATTTCAGCC No data
Right 1098979115 12:76935990-76936012 AGTAACCATTTATTGTATATTGG No data
1098979111_1098979115 11 Left 1098979111 12:76935956-76935978 CCAATTAATGCCATAAGTTTATT No data
Right 1098979115 12:76935990-76936012 AGTAACCATTTATTGTATATTGG No data
1098979110_1098979115 30 Left 1098979110 12:76935937-76935959 CCTAGATGGTCTTGTCTGGCCAA No data
Right 1098979115 12:76935990-76936012 AGTAACCATTTATTGTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098979115 Original CRISPR AGTAACCATTTATTGTATAT TGG Intergenic
No off target data available for this crispr