ID: 1098980731

View in Genome Browser
Species Human (GRCh38)
Location 12:76952898-76952920
Sequence TAATTTGGAAGGCCGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098980731_1098980736 -10 Left 1098980731 12:76952898-76952920 CCTTGCCTCGGCCTTCCAAATTA No data
Right 1098980736 12:76952911-76952933 TTCCAAATTATTGGGATTGCAGG No data
1098980731_1098980738 9 Left 1098980731 12:76952898-76952920 CCTTGCCTCGGCCTTCCAAATTA No data
Right 1098980738 12:76952930-76952952 CAGGCATTAGCAATTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098980731 Original CRISPR TAATTTGGAAGGCCGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr