ID: 1098981715

View in Genome Browser
Species Human (GRCh38)
Location 12:76963218-76963240
Sequence CTCTCTCTGGGGCTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098981701_1098981715 26 Left 1098981701 12:76963169-76963191 CCAGATGCACCTCTTTGTCCCAC No data
Right 1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG No data
1098981706_1098981715 7 Left 1098981706 12:76963188-76963210 CCACTGGCAGTGCTGGATGAAGG No data
Right 1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG No data
1098981703_1098981715 17 Left 1098981703 12:76963178-76963200 CCTCTTTGTCCCACTGGCAGTGC No data
Right 1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG No data
1098981705_1098981715 8 Left 1098981705 12:76963187-76963209 CCCACTGGCAGTGCTGGATGAAG No data
Right 1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098981715 Original CRISPR CTCTCTCTGGGGCTGGTGGA AGG Intergenic
No off target data available for this crispr