ID: 1098986476

View in Genome Browser
Species Human (GRCh38)
Location 12:77017847-77017869
Sequence TTGTAGGAAGGGAGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1768
Summary {0: 1, 1: 1, 2: 10, 3: 130, 4: 1626}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098986476 Original CRISPR TTGTAGGAAGGGAGGGAAAG TGG Intergenic
900017420 1:162293-162315 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900047679 1:520889-520911 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900069893 1:762757-762779 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900369512 1:2325101-2325123 GGGAAGGAAGGGAAGGAAAGGGG - Intronic
900725542 1:4214162-4214184 GGGAAGGAAGGGAGGGAAGGAGG - Intergenic
900836881 1:5011593-5011615 TAGAAGGTGGGGAGGGAAAGTGG + Intergenic
900859718 1:5219603-5219625 TTGAAGGAGGTGAGGGATAGAGG - Intergenic
901064819 1:6489662-6489684 TGGTAGGGAGCGGGGGAAAGAGG + Intronic
901266416 1:7914186-7914208 GAGAGGGAAGGGAGGGAAAGCGG - Intergenic
901659825 1:10792097-10792119 TTGGAGGGAGGGAGGTAGAGTGG - Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901938568 1:12644926-12644948 GGGAAGGAAGGGAGGGAGAGAGG - Intronic
901955018 1:12777712-12777734 ATGCAGGAAGGGAGGGACTGGGG + Exonic
902039426 1:13482155-13482177 TGGAAGGAAGGCAGGGAGAGTGG + Intronic
902289478 1:15427102-15427124 TGTCAGGAAGGGAGGGAAGGAGG - Intronic
902293669 1:15451507-15451529 TGGCTGGAAGGGAGGGAAACTGG + Intergenic
902635865 1:17734921-17734943 TTGGTGGGAGGGAGGGAGAGGGG - Intergenic
902698252 1:18154786-18154808 AGAAAGGAAGGGAGGGAAAGAGG - Intronic
902811917 1:18892775-18892797 TTTTAGGGAGGGAGGGAAACTGG - Intronic
902960477 1:19959705-19959727 GGGTAGAAAGGGAGGGAAGGAGG - Intergenic
903021772 1:20400018-20400040 CTGTAGGAAGGCAGGGGAGGAGG - Intergenic
903696705 1:25212781-25212803 CTGTAAGAAGGGAGGAAATGAGG - Intergenic
903740706 1:25556895-25556917 GTGTGGGATGGGAGGGAGAGGGG + Intronic
903746606 1:25591109-25591131 CTGAAGGAAGTGAGGAAAAGAGG - Intergenic
903845222 1:26275853-26275875 AGGTAGGAAGGGAAGGAAAGTGG + Intronic
904104729 1:28069625-28069647 GAGAAGGAAGGAAGGGAAAGAGG + Intronic
904212907 1:28897563-28897585 AGGTAGGAAGGGAAGGGAAGCGG + Intronic
904298129 1:29536671-29536693 AGGCAGGAAGGGAGGGAAGGAGG - Intergenic
904480743 1:30791748-30791770 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
904928790 1:34069764-34069786 TTGGAGAAAGGAGGGGAAAGGGG + Intronic
905180924 1:36166095-36166117 CTGAAGGAGGGGAGGGAACGAGG + Intronic
905204189 1:36333608-36333630 GTGTAGGGATGGAGGGAGAGCGG - Intergenic
905252547 1:36658893-36658915 TTGGAGGGAGGGAGGAAATGGGG + Intergenic
905309111 1:37037372-37037394 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
905309138 1:37037430-37037452 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
905328130 1:37172605-37172627 TTGTTGGAAGGAAGAGAAACAGG - Intergenic
905481914 1:38267747-38267769 AAGTAGGGAGGGAGGGAGAGAGG - Intergenic
905658716 1:39703336-39703358 TGGTTGGATGGGAAGGAAAGGGG - Intronic
906225276 1:44117032-44117054 GGGTAGGGAGGGAGGGAAAGAGG - Intergenic
906275226 1:44510288-44510310 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
906311892 1:44760189-44760211 CTCTAGGAAGGGAGGGACACAGG - Intronic
906700114 1:47851476-47851498 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
906939038 1:50239459-50239481 TTTTAAGAAGGGAGGGGAATGGG - Intergenic
907126023 1:52051858-52051880 TTTTTGGAAGGTAGGGTAAGTGG + Intronic
907495475 1:54841382-54841404 TTGGAGCAGTGGAGGGAAAGTGG + Intronic
907560425 1:55382558-55382580 TTGGAGGTAGAGAGAGAAAGAGG + Intergenic
907676429 1:56521759-56521781 TGGAAGGAAGGAAGAGAAAGAGG - Intronic
907907757 1:58799803-58799825 TGGGAGGAAGGAAGGGACAGAGG - Intergenic
907977388 1:59445129-59445151 TTGGAAGGAGGGAGAGAAAGAGG + Intronic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908524335 1:64973312-64973334 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
908732350 1:67239011-67239033 CTGAAGGAAGGGAGGGAGTGAGG + Intronic
909876126 1:80805982-80806004 CTGGAGGATGGGAGGAAAAGTGG - Intergenic
910051308 1:82977521-82977543 AAGAAGGAAGGGAGGGAGAGAGG - Intergenic
910128543 1:83874133-83874155 GGGTAGGAAGGAAGGGAAAATGG - Intronic
910159874 1:84261205-84261227 TTGTAACAAAGGAGGGAAAATGG + Intergenic
910393570 1:86769151-86769173 TGGAAGGAAGGGAGGGAGGGAGG + Intergenic
910597974 1:88999575-88999597 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
910751809 1:90639033-90639055 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
910775517 1:90870947-90870969 TTGTGGGCTAGGAGGGAAAGTGG - Intergenic
910820056 1:91336390-91336412 ATGGAGGTAAGGAGGGAAAGGGG - Intronic
910860028 1:91734035-91734057 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
911032137 1:93500453-93500475 AGAAAGGAAGGGAGGGAAAGAGG + Intronic
911065848 1:93787242-93787264 TTGAAGGAATGGAGGAAAAGGGG + Intronic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
911860450 1:102941157-102941179 TTAAGGGAAGTGAGGGAAAGTGG - Intronic
912308542 1:108595708-108595730 GGGAAGGAAGGGAGGGAGAGAGG + Intronic
912437723 1:109673571-109673593 TGGTGGGAAGGGAGGGATGGAGG + Intronic
912667391 1:111594502-111594524 TGGAAGGAAGGAAGGGGAAGGGG + Intronic
913063448 1:115228499-115228521 ACGGAGAAAGGGAGGGAAAGAGG - Intergenic
913400769 1:118430332-118430354 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
913550071 1:119908585-119908607 TTCTAGGAGGCAAGGGAAAGGGG + Intergenic
913707542 1:121441835-121441857 ATGGAGGAAGGGATGGAAAAGGG - Intergenic
914194738 1:145440512-145440534 AGGTAGGGAGGGAGGGAGAGTGG - Intergenic
914362269 1:146945091-146945113 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
914476013 1:148023077-148023099 AGGTAGGGAGGGAGGGAGAGTGG - Intergenic
914489406 1:148141987-148142009 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
914711829 1:150221526-150221548 TGGGAGGAAGGGAGGGAGGGAGG + Intronic
914711847 1:150221575-150221597 TGGGAGGAAGGGAGGGAGGGAGG + Intronic
914764271 1:150624279-150624301 TTGGAGGAAGCTGGGGAAAGTGG - Intronic
914959230 1:152191454-152191476 GTGTAGGCATGAAGGGAAAGGGG - Intergenic
914991189 1:152501008-152501030 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
915127744 1:153678053-153678075 TTGTAGGAAGATGGGGAGAGTGG - Intergenic
915138639 1:153752168-153752190 TTCTAGGGAGGGAAGGAAAGAGG - Intronic
915518627 1:156428629-156428651 TCATAGGAAAGGGGGGAAAGGGG + Intronic
915716573 1:157950168-157950190 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
915923656 1:159998684-159998706 TTGTCAGAAAGGAGGAAAAGGGG + Intergenic
915929865 1:160053697-160053719 CTAGAGGATGGGAGGGAAAGGGG - Intronic
916204668 1:162304210-162304232 TTGCAGAGAGGGAGGGAGAGAGG - Intronic
916228453 1:162514596-162514618 TTGTAGGAAGGAAGGAAAGAAGG + Intronic
916288353 1:163135765-163135787 TTGGAGGAAGGGAGGGCATTAGG - Intronic
916414988 1:164584103-164584125 AGGAAGGAAGGGAGGGAGAGGGG + Intronic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916702178 1:167308525-167308547 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
916750515 1:167719501-167719523 TTGAGGGGAGTGAGGGAAAGAGG - Intergenic
916779442 1:168008896-168008918 TGGGAGGAAGGGAGGGAGGGAGG - Intronic
916779520 1:168009469-168009491 GTGAAGGAAGGGAGGGAGGGAGG - Intronic
917104650 1:171480281-171480303 CAGGAAGAAGGGAGGGAAAGAGG - Intergenic
917234355 1:172874237-172874259 TCTTAGGAAGGGAAGGAAAAGGG + Intergenic
917500256 1:175579123-175579145 TAGGAGGAAGGGAGGGAGGGAGG - Intronic
918102174 1:181385878-181385900 ATGAAGGAAGGGAGGAAGAGAGG - Intergenic
918357156 1:183715756-183715778 ATGTAGAAAGGGAGGGAGGGAGG + Intronic
918446476 1:184622215-184622237 AAGGAGGAAGGGAGGGTAAGTGG + Exonic
918458497 1:184752303-184752325 TTGTTGGTGGGGAGGGAAAGGGG + Intronic
918502847 1:185217584-185217606 AGGAAGGGAGGGAGGGAAAGAGG - Intronic
918546204 1:185687436-185687458 AGGAAGGGAGGGAGGGAAAGAGG - Intergenic
918607145 1:186441687-186441709 TTGCAGGAAGGGAAGAAAGGAGG - Intergenic
918640603 1:186837093-186837115 TGGGAGCAAAGGAGGGAAAGTGG + Intronic
918801494 1:188978383-188978405 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
918801518 1:188978448-188978470 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
919037582 1:192334829-192334851 TTGGGGGAAGGGAAAGAAAGTGG - Intronic
919399058 1:197086238-197086260 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
919464503 1:197912913-197912935 TTCTTGGAAGGGATGGAAGGGGG + Intronic
919509788 1:198447710-198447732 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
919750098 1:201032219-201032241 AAGCAGGAAGGGAGGGAGAGAGG - Intergenic
919798703 1:201337521-201337543 AGGAAGGAAGGGAGGGAAAGGGG + Intergenic
920002996 1:202812049-202812071 TTGTTGAAAGGGAGGGTAAATGG + Intergenic
920162818 1:204012555-204012577 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
920216986 1:204367901-204367923 TTGTGGGAAGAGAGGAAGAGAGG - Intronic
920276003 1:204804785-204804807 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
920406538 1:205717624-205717646 TTGTAGGGAGGGTGGGCAATGGG - Exonic
920544213 1:206802025-206802047 TTGCAGGAAAGGAGGGGAAGGGG + Intronic
920739142 1:208563748-208563770 TAGTACGGAGGGAGGGAGAGGGG + Intergenic
920905826 1:210166558-210166580 TTGTAGAAAGGGAGGAAGAAAGG + Intronic
921050665 1:211509044-211509066 TTTTTGGAAGGCAGGGAGAGGGG + Intergenic
921109688 1:212022889-212022911 AGGGAGGAAGGGAGGGAGAGGGG - Intronic
921317307 1:213904960-213904982 AGGTAGGAAGAGAGGGAAAAAGG + Intergenic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921470940 1:215548514-215548536 TTGTAGGAACGTAGGTATAGTGG + Intergenic
921540415 1:216407118-216407140 TGGGAGGAAGGGAAAGAAAGAGG - Intronic
921790407 1:219283476-219283498 GTGTGGAAAGGGATGGAAAGTGG + Intergenic
922057441 1:222054962-222054984 AAGAAGGAAGGAAGGGAAAGAGG + Intergenic
922105260 1:222508207-222508229 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922179689 1:223224016-223224038 CTGTAGGATGGGATTGAAAGTGG + Intronic
922265575 1:223980741-223980763 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922265581 1:223980757-223980779 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922553112 1:226511723-226511745 TAGTAGGGAAGGAGGGTAAGGGG + Intergenic
922593174 1:226794217-226794239 GTATAGGCAGGGATGGAAAGAGG - Intergenic
922846737 1:228691413-228691435 TTGGAGGGAGGGAGGGAGGGAGG - Intergenic
922995161 1:229951598-229951620 AGGGAGGAAGGGAGGAAAAGAGG + Intergenic
923143750 1:231183605-231183627 TTGTTGGGAGGGAGGGATGGGGG - Intronic
923705107 1:236337605-236337627 TTGTAGTAAGGGAGAGAAACAGG + Intergenic
923946036 1:238888671-238888693 TGGTACCAAGGGAGGGAAAATGG + Intergenic
924347436 1:243085744-243085766 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
924585734 1:245359697-245359719 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
924602579 1:245504391-245504413 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
924852045 1:247840344-247840366 TTGTGGGAAGGAAGGGAGGGAGG - Intergenic
1062966052 10:1608630-1608652 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1063156347 10:3382399-3382421 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1063422596 10:5925225-5925247 TTGTAGGAAAAGGGGGAAAGAGG - Intronic
1063623968 10:7672081-7672103 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1063921486 10:10937845-10937867 ATATATGGAGGGAGGGAAAGAGG + Intergenic
1063984205 10:11483661-11483683 GGGTAGGGAGGGAGGGAGAGAGG + Intronic
1064114823 10:12568506-12568528 GGGGAGGGAGGGAGGGAAAGAGG - Intronic
1064131771 10:12716096-12716118 TTCTAGGAAGGGGGAGAATGAGG + Intronic
1064142148 10:12799398-12799420 TAGGAGGGAGGGAGGGAAAGAGG + Intronic
1064210515 10:13357247-13357269 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1064476698 10:15698055-15698077 TGGGAGAAAGGGTGGGAAAGGGG - Intronic
1064526315 10:16260401-16260423 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1064686455 10:17867110-17867132 AGGGAGGAAGGGAGGGTAAGGGG - Intronic
1064704674 10:18059547-18059569 TCAGAGGAAAGGAGGGAAAGAGG - Intergenic
1065005067 10:21371756-21371778 AGGAAGGAAGGGAGGGAAAAAGG + Intergenic
1065169157 10:23010363-23010385 GGGAAGGAAGGGAAGGAAAGGGG - Intronic
1065371775 10:24994272-24994294 ATGAAGGAAGGGAGGGAGAAAGG - Intronic
1065372160 10:24998334-24998356 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1065420436 10:25537815-25537837 GAGGAGGAAGGGAGTGAAAGAGG - Intronic
1065450159 10:25848421-25848443 AGGGAGGAAGGGAGGGAAAAGGG + Intergenic
1065638333 10:27753390-27753412 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1065638341 10:27753422-27753444 AAGCAAGAAGGGAGGGAAAGAGG - Intergenic
1065856949 10:29838828-29838850 AGGAAGGAAGGGAGGGAGAGGGG + Intergenic
1065875309 10:29992809-29992831 TTTTAGGCAGATAGGGAAAGCGG - Intergenic
1065885541 10:30073742-30073764 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1065933534 10:30500136-30500158 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1065996800 10:31066915-31066937 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1066402661 10:35090492-35090514 CGGTAGGGAGGGGGGGAAAGGGG + Intronic
1066487018 10:35856053-35856075 AGGTAGGAAGGGAGGGAGGGAGG - Intergenic
1066553334 10:36583953-36583975 AGGAAGGAAGGGAGGGAAAAAGG - Intergenic
1066696826 10:38086461-38086483 TTTCAGGATGGAAGGGAAAGTGG - Intergenic
1067202487 10:44185374-44185396 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1067256887 10:44650137-44650159 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
1067292597 10:44955085-44955107 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1067557799 10:47284832-47284854 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1067720322 10:48723170-48723192 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1067836490 10:49644704-49644726 TTGCAAAAAGTGAGGGAAAGGGG + Intronic
1068064622 10:52113420-52113442 CAGAAGGGAGGGAGGGAAAGAGG + Intronic
1068704139 10:60054552-60054574 TTGTTAGAAGGGAGAGTAAGAGG - Intronic
1068767259 10:60777625-60777647 TTCTATGAGGGGAGAGAAAGAGG - Intergenic
1068825910 10:61438787-61438809 ATGTGGTAAGGGAGGAAAAGTGG - Intronic
1069024897 10:63528827-63528849 CTGAAGGAAGCGAGGGAATGAGG - Intronic
1069232996 10:66035512-66035534 TAGTAGGAATAGAGGGAATGAGG + Intronic
1069354906 10:67573753-67573775 TTGAGGGAAGGGAAGGATAGAGG - Intronic
1069587120 10:69614604-69614626 TCATAGGAAGGGAGAGAAATAGG - Intergenic
1069673621 10:70232226-70232248 GTGTATGAAGGAAGGGGAAGCGG - Intronic
1070009223 10:72456017-72456039 TTCTGGGAAGGAAGGGAATGAGG + Intronic
1070037683 10:72742921-72742943 AGGTAGGAAGTCAGGGAAAGGGG + Intronic
1070065310 10:73027831-73027853 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070129123 10:73644624-73644646 ATGAGGCAAGGGAGGGAAAGGGG + Intergenic
1070332931 10:75431133-75431155 TTGTAGGAGGGGAGGGGGATTGG - Intergenic
1070472179 10:76792146-76792168 TTGTGGTAAGGCATGGAAAGGGG - Intergenic
1070661791 10:78311765-78311787 AGGAAGGAAGGGAGGGACAGAGG - Intergenic
1070694045 10:78548639-78548661 GGGAAGGAAGGGAAGGAAAGAGG + Intergenic
1070746944 10:78939477-78939499 GTGTAGGAGGGGAGGGCAAGAGG - Intergenic
1071137511 10:82469202-82469224 CGGAAGGAAGGGAGGGAAAAGGG - Intronic
1071234646 10:83631254-83631276 GTGTAGGGTGGGAGGGATAGGGG + Intergenic
1071329086 10:84542917-84542939 TTGCAGCAAGGGAGGCAGAGGGG - Intergenic
1071583480 10:86795646-86795668 TAGTAGGGAGGGAGGGAATTAGG + Intronic
1071729907 10:88237309-88237331 TTGAAGGAAGGAAGGGGAAGAGG - Intergenic
1071839435 10:89454015-89454037 ATGAAGGAAGGGAGGGAGCGAGG - Intronic
1071982691 10:91019680-91019702 TTGGAGTAAGGGAGGTAAAAAGG + Intergenic
1072235145 10:93447296-93447318 CTTAAGGAAGGGAGGTAAAGGGG - Intronic
1072538503 10:96381038-96381060 TTGGAGGAAGGAAGGGAGAGAGG - Intronic
1072554070 10:96501366-96501388 GAATGGGAAGGGAGGGAAAGTGG - Intronic
1072726431 10:97816804-97816826 TTGTAGGTAAGGAGGGGCAGGGG + Intergenic
1073433061 10:103499396-103499418 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1073482537 10:103795863-103795885 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1073519614 10:104115258-104115280 GGGAAGGAAGGGAGGGAAGGGGG - Intergenic
1073624586 10:105083851-105083873 TTGGAGAAAGGGAGGCAATGAGG + Intronic
1073649077 10:105339931-105339953 GGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1073649103 10:105339990-105340012 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1074403799 10:113163831-113163853 TGGCAGGAAGGCAGGGAAGGAGG - Intronic
1074651420 10:115527883-115527905 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1074731824 10:116386493-116386515 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1074906653 10:117870118-117870140 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
1075065655 10:119287350-119287372 AAGGAGGAAGGGAGGGAGAGAGG + Intronic
1075105571 10:119538115-119538137 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1075576803 10:123583786-123583808 GCGTCGGAAGGGTGGGAAAGCGG + Intergenic
1075845502 10:125542081-125542103 TTGGAGAAAGGGTGGGAAGGAGG + Intergenic
1076138742 10:128063263-128063285 TGGGAGGAAGGGAGGGAAGTAGG - Intronic
1076201536 10:128562730-128562752 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1076571968 10:131438936-131438958 AGGCAGGAAGGGAGGGAAAGAGG - Intergenic
1076577918 10:131483263-131483285 GTTTATGAAGGGAGGGATAGAGG + Intergenic
1076652783 10:132001390-132001412 AGGTAGGAAGGCAGGGAAGGAGG + Intergenic
1076947469 10:133660984-133661006 TTTCAGGAAGGAAGGGAAAAGGG + Intergenic
1076974016 11:157499-157521 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1077253305 11:1570206-1570228 TGGTGGGAAGGGAGGGAACCTGG - Intronic
1077272253 11:1686821-1686843 GAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1077355870 11:2116716-2116738 TTGGAGGAAGGGAAGGATAGAGG + Intergenic
1077479926 11:2808985-2809007 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1078029034 11:7729724-7729746 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
1078758955 11:14236313-14236335 TTGCAGGGTGGGAGAGAAAGAGG + Intronic
1078760330 11:14246225-14246247 AGATAGGAAGGGAGGGAGAGAGG + Intronic
1078846298 11:15121745-15121767 TGATAGGAAGGGAGGGAGTGGGG - Intronic
1078852633 11:15178492-15178514 TTGGAGGAAAGGAGAGAAAGAGG + Intronic
1078966291 11:16348034-16348056 GAGTAGAAAGGGAGGGGAAGAGG + Intronic
1079134606 11:17769313-17769335 TGGTTGGAAGGGAGGGATGGAGG + Intronic
1079137690 11:17785189-17785211 GTGTGAGAAGGAAGGGAAAGAGG - Intergenic
1079189375 11:18265072-18265094 GGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1079303279 11:19298459-19298481 TAGAAGGAAGGGAGGGGAAGGGG - Intergenic
1079497730 11:21064652-21064674 ATGGAGGAAGGATGGGAAAGTGG + Intronic
1079540931 11:21573770-21573792 AGGAAGGGAGGGAGGGAAAGAGG + Intronic
1079587076 11:22139433-22139455 AAGTAGGAAGAGAGGGAGAGAGG - Intergenic
1079754846 11:24244425-24244447 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
1079868711 11:25768088-25768110 ATGAAGGAAGGAAGGAAAAGAGG + Intergenic
1079920193 11:26424134-26424156 GTGTAGTAAGTGAGAGAAAGAGG - Intronic
1079968080 11:27003323-27003345 CTGGAGGCAGAGAGGGAAAGAGG - Intergenic
1080017773 11:27525659-27525681 TAGGAGGAAGGCAGGGAAGGTGG + Intergenic
1080156503 11:29117768-29117790 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1080156632 11:29118753-29118775 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1080391911 11:31855872-31855894 TAGCAGGTAGGGAGGGAAATAGG - Intronic
1080437489 11:32259165-32259187 CTGAAGGGAGGGAGGGACAGAGG - Intergenic
1080558195 11:33436809-33436831 ATGGAGGAAGGGCAGGAAAGGGG + Intergenic
1080774280 11:35371283-35371305 CACTAGGAAGGGAGGGAATGTGG - Intronic
1081461510 11:43276609-43276631 TCAGGGGAAGGGAGGGAAAGGGG - Intergenic
1081655316 11:44853358-44853380 TTTTGGGAAGGGAGAGAGAGTGG + Intronic
1081655822 11:44856829-44856851 GTGTAGGGAGGGAGGGAGGGAGG - Intronic
1081659482 11:44879251-44879273 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1081833941 11:46137957-46137979 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1081963473 11:47155109-47155131 TTTAAGGAGGGGAGGGAGAGAGG - Intronic
1082181103 11:49120854-49120876 TGGAAGGAAGGAAGGGAAGGAGG - Intergenic
1082208561 11:49468989-49469011 TGGAAGGAAGGGAGGGAGGGTGG - Intergenic
1082761878 11:57135375-57135397 AGGCAGGAAAGGAGGGAAAGAGG + Intergenic
1083341080 11:61958792-61958814 AGGTAGGAAGGGAGAGAGAGTGG - Intronic
1083392174 11:62360816-62360838 TTACAGGAATTGAGGGAAAGAGG + Intronic
1083743381 11:64722695-64722717 TTGGGGGAAGGGATGGAGAGAGG - Intronic
1083802912 11:65057291-65057313 CTGGAGGAAGTGAGGGGAAGGGG - Intronic
1084072415 11:66744924-66744946 TGCTGGGAAGGGAGAGAAAGCGG + Intronic
1084191094 11:67499099-67499121 TTGGAGGAAGGTAGGGACTGGGG - Intronic
1084437193 11:69150166-69150188 TTGGAGGATGGGAGGGAAGGAGG - Intergenic
1084772644 11:71353836-71353858 ATGGAGGGAGGGAGGGAAAGAGG + Intergenic
1084928688 11:72535958-72535980 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1085271479 11:75272702-75272724 AGGAAGGAAGAGAGGGAAAGCGG + Intronic
1085479106 11:76806983-76807005 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1085698823 11:78728552-78728574 GGGAAGGAAGGGAGGGAAGGAGG - Intronic
1085853233 11:80145973-80145995 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1085983675 11:81757363-81757385 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086329397 11:85738436-85738458 ATAGAGGATGGGAGGGAAAGGGG + Intronic
1086420641 11:86634068-86634090 TTGTAGGAATGGAAGGAGAGGGG - Intronic
1086783878 11:90940826-90940848 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1087055855 11:93935626-93935648 TTGTAAGTAGGGAAGTAAAGTGG - Intergenic
1087086611 11:94225636-94225658 TTGTAAGAAGGAGGGGAAAAAGG + Intergenic
1087405802 11:97728462-97728484 TGGGAGGAAGGGTGGGAGAGGGG + Intergenic
1087547099 11:99598405-99598427 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1087906107 11:103699724-103699746 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1087985732 11:104677212-104677234 TTGCAGGGAGGGAGGGAAAGAGG - Intergenic
1088031957 11:105262087-105262109 CTGGAGGGAGGGAGGGAGAGAGG + Intergenic
1088036222 11:105319028-105319050 GGGTAGGAAGGTAGGGAATGTGG + Intergenic
1088453434 11:110007540-110007562 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1089029382 11:115308767-115308789 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
1089029393 11:115308798-115308820 TGGAAGGAAGGGAGGGAGGGAGG - Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089232484 11:116991493-116991515 TTGAGGGAAGGGAGAGAAACAGG + Intronic
1089393599 11:118118683-118118705 AGGCAGGGAGGGAGGGAAAGAGG - Exonic
1089580036 11:119476005-119476027 GTGAAGGGAGGGAGGGAGAGAGG + Intergenic
1089775569 11:120833076-120833098 TGGGAGGGAGGGAGGGAAGGAGG - Intronic
1090004862 11:122992701-122992723 TGGCTGGAAGAGAGGGAAAGGGG - Intergenic
1090016981 11:123094783-123094805 TTTTAAGAAAGGAGGGGAAGGGG - Intronic
1090019453 11:123114447-123114469 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1090142738 11:124282253-124282275 TGGCAGGAAGGGTGGGAGAGGGG + Intergenic
1090240483 11:125177944-125177966 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1090481712 11:127074688-127074710 TTTTAGTCGGGGAGGGAAAGAGG - Intergenic
1090648263 11:128783984-128784006 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1090931547 11:131302011-131302033 TTGTGGGTTGGGTGGGAAAGGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091113802 11:132995442-132995464 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1091142808 11:133250493-133250515 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
1091191722 11:133701277-133701299 TTGAAGGAGAAGAGGGAAAGAGG - Intergenic
1091394681 12:146697-146719 TGGGAGGAAGGGAGGGAGGGAGG + Intronic
1091842010 12:3628114-3628136 GTGAAGGAAGGGAGGGAGGGAGG - Intronic
1091856703 12:3746391-3746413 GTGGAGGAAGGGTGGGGAAGAGG - Intronic
1091996122 12:4995597-4995619 ATGTGGGAGGGGATGGAAAGGGG - Intergenic
1092164793 12:6336228-6336250 CTGGAGGGAGGGAGGGAGAGAGG + Intronic
1092213867 12:6667005-6667027 TTGTAGGCAGAGAAGGAGAGAGG + Exonic
1092354629 12:7784306-7784328 TTGGAGGAAGAGGGGGCAAGAGG - Intergenic
1092462580 12:8698702-8698724 TTGTGGGAAGGGGGGGGAGGGGG - Intronic
1092511936 12:9166005-9166027 TTGCTGGAGGGGAGGGAATGTGG - Intronic
1092953588 12:13529693-13529715 TTGTTGGAAGGAAGGAAAGGAGG + Intergenic
1093084454 12:14851336-14851358 TTGTTGTAAGGCAGGGCAAGGGG - Intronic
1093534709 12:20209755-20209777 CTGTAAGAAGGAAGGGAATGAGG + Intergenic
1093971108 12:25376854-25376876 AAGAGGGAAGGGAGGGAAAGGGG + Intergenic
1094216138 12:27944740-27944762 CTGAAGGAAGCAAGGGAAAGAGG - Intergenic
1094230223 12:28094111-28094133 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1094330386 12:29285552-29285574 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1094372298 12:29751494-29751516 GGGAAGGAAGGGAGGGAAATAGG + Intronic
1094531179 12:31276708-31276730 TTATAGGATGGTAGGGAAACGGG + Intergenic
1094715322 12:33008198-33008220 AAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1095385513 12:41645642-41645664 TGGAGGGAAGGGAGGGAGAGAGG + Intergenic
1095385540 12:41645755-41645777 AGGAAGGGAGGGAGGGAAAGGGG + Intergenic
1095535028 12:43235088-43235110 TAATAGGAAGGGAGGGAAGGAGG + Intergenic
1095973838 12:47925603-47925625 TTGAAAGAAAGGAAGGAAAGAGG - Intronic
1095999375 12:48116113-48116135 AGGAAGGAAGGGAGGGAAGGGGG - Intronic
1096009557 12:48201512-48201534 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1096130358 12:49154161-49154183 TGGCAGGAAGGGAGGGATAGAGG - Intergenic
1096767018 12:53899452-53899474 ATGAAGGAAGGAAGGGAAAAAGG + Intergenic
1096790327 12:54040377-54040399 TGGTGGGAAGGGAGGGAGGGAGG - Intronic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1097342476 12:58454481-58454503 TGGAAGGAAGGGAAGGGAAGGGG - Intergenic
1097393231 12:59041061-59041083 TTGTAGGAGGTGAGGGAAACTGG - Intergenic
1097792555 12:63830111-63830133 TTGCAGGATCGGGGGGAAAGGGG + Intergenic
1097829140 12:64205644-64205666 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1097883098 12:64703987-64704009 TAGAAAGGAGGGAGGGAAAGAGG - Intergenic
1097968229 12:65603815-65603837 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1097991097 12:65834635-65834657 TTGAAGGAAGGGAAGGAGGGAGG - Intronic
1098170059 12:67737855-67737877 TTGAAGGGAGGAAAGGAAAGAGG - Intergenic
1098521762 12:71440819-71440841 AGGAAGGAAGGGAGGAAAAGAGG - Intronic
1098820864 12:75227223-75227245 ATGGAGGGAGGGAGGGACAGAGG + Intergenic
1098901254 12:76114154-76114176 TTCTTAGAAGGGAGGGATAGGGG + Intergenic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1099079648 12:78160858-78160880 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1099439918 12:82687126-82687148 CTGGAGGAAGAGAGAGAAAGAGG - Exonic
1099962794 12:89412887-89412909 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1100141151 12:91620499-91620521 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1100141164 12:91620537-91620559 AGGCAGGAAGGAAGGGAAAGAGG + Intergenic
1100149557 12:91719792-91719814 TAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1100149606 12:91720053-91720075 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1100594842 12:96062875-96062897 TTTTAGGGAGGGAGAGAGAGAGG + Intergenic
1100602086 12:96120736-96120758 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1100807742 12:98305013-98305035 TAGCAGGAAGGGAGGGAGAAAGG - Intergenic
1100828461 12:98496456-98496478 TTGTAGGAACAGAGGAAATGTGG - Intronic
1100862235 12:98818212-98818234 GTTAAGGAAGGAAGGGAAAGAGG - Intronic
1101255584 12:102973733-102973755 ATGAAGGAAGGAAGGGAAAGAGG - Intergenic
1101916951 12:108903248-108903270 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1102426571 12:112848637-112848659 TGGTAGGAAGGAGGGGAAAGTGG + Intronic
1102556339 12:113729299-113729321 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1102660931 12:114527696-114527718 AGGAAGGAAGGGAGGGAAAGAGG - Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102886413 12:116525417-116525439 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1102893222 12:116578316-116578338 AGGTAGGGAGGGAGGGAGAGAGG - Intergenic
1102992131 12:117322798-117322820 AAGGAGGAAGGGAGGGAAGGAGG - Intronic
1103040348 12:117690036-117690058 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1103110293 12:118271344-118271366 TCTTAGGAATGGAGGGAATGGGG - Intronic
1103147637 12:118609344-118609366 TTGAGGGGAAGGAGGGAAAGAGG + Intergenic
1103149679 12:118626216-118626238 ATAGAGGAAGGGAGGAAAAGAGG - Intergenic
1103230192 12:119323583-119323605 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1103366839 12:120389805-120389827 AGGTAGGAAGGCAGGGAAAAAGG + Intergenic
1103639010 12:122333427-122333449 CTGAAGGAAGTGAGGGAATGGGG + Intronic
1103706828 12:122879452-122879474 TTGGAGGAAGGGAGGGTTGGAGG - Intronic
1103925667 12:124422341-124422363 TGGAAGGAAGGGAGGGAGGGAGG + Intronic
1103976684 12:124707258-124707280 TAGGAGGAAGGGAGGGAGGGAGG + Intergenic
1104772860 12:131375095-131375117 TAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1105316043 13:19264816-19264838 AGGGAGGGAGGGAGGGAAAGGGG - Intergenic
1105694406 13:22873584-22873606 ATGGAGGGAGGGAGGGAAAGAGG - Intergenic
1105922960 13:24982559-24982581 TAAGAGGAAGGAAGGGAAAGAGG - Intergenic
1106137803 13:26987321-26987343 GTGAAGGAAGAGAGGAAAAGGGG - Intergenic
1106363036 13:29050102-29050124 GTGTAGGTAAGGAGAGAAAGGGG - Intronic
1106582722 13:31031872-31031894 TGGTAAGAAAGGAGGAAAAGCGG - Intergenic
1106684334 13:32042180-32042202 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1107088647 13:36452114-36452136 TGGAAGGAAGGAAGGGACAGAGG - Intergenic
1107337373 13:39369602-39369624 GGGAAGGAAGGGAGGGAGAGAGG - Intronic
1107596112 13:41964678-41964700 TTATAGAGAGGGAGGGAAAAAGG + Intergenic
1107705342 13:43097618-43097640 TTGTAGTAGAGGAGGTAAAGGGG + Intronic
1107879154 13:44817863-44817885 TTGGAGGAGCGGAGGCAAAGCGG - Intergenic
1108433218 13:50375654-50375676 ATGGAGGAAGGGAAGGGAAGGGG - Intronic
1108490210 13:50974412-50974434 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1108514818 13:51191120-51191142 GAATAGGAATGGAGGGAAAGGGG - Intergenic
1108548890 13:51523324-51523346 TCCTAGGATGGGAGGGAAACTGG - Intergenic
1109403097 13:61861015-61861037 TTGAAGAAAGGAAGGTAAAGAGG - Intergenic
1109447005 13:62454087-62454109 TTGTGGGCATTGAGGGAAAGGGG - Intergenic
1109458671 13:62626486-62626508 CTGAAGGAAGGAAGGGAATGGGG - Intergenic
1109704358 13:66070590-66070612 TTGTAAAAATGGAGGGAAAATGG + Intergenic
1109898178 13:68723184-68723206 TTGCAGTAAGTGAGAGAAAGGGG + Intergenic
1110241712 13:73274701-73274723 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1110325751 13:74213567-74213589 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1110702307 13:78562961-78562983 TTGAAGGGAGGGAGGAAATGTGG - Intergenic
1111086433 13:83380739-83380761 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1111142569 13:84139648-84139670 TTGGAGGTAGGGAAGGAGAGAGG - Intergenic
1111452597 13:88438677-88438699 AGGGAGGAAGGGAGGGACAGAGG + Intergenic
1111452623 13:88438752-88438774 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1111488546 13:88938097-88938119 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1111570171 13:90073796-90073818 TTTGAGGAGGGGAGGGAGAGGGG + Intergenic
1111887595 13:94042158-94042180 TAGGAGGAAGAGAGGGAAGGGGG - Intronic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112050029 13:95635935-95635957 AAGGAGGTAGGGAGGGAAAGAGG + Intronic
1112110011 13:96285987-96286009 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1112126368 13:96472777-96472799 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1112221903 13:97499667-97499689 TTTGAGGAAGAGAAGGAAAGTGG + Intergenic
1112477282 13:99743316-99743338 TTGTGGGAACAAAGGGAAAGAGG + Intronic
1112629201 13:101141739-101141761 CTGTGGGAAGGGAAAGAAAGCGG + Intronic
1113251585 13:108458675-108458697 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
1113314442 13:109163495-109163517 TGGGAGGGAGGGAGGGAAGGAGG - Intronic
1113364307 13:109661898-109661920 GTGTAGGAAGGGAGGAAAAGGGG + Intergenic
1113420758 13:110170026-110170048 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113520238 13:110935461-110935483 TTGTAAGAAGAGAGGAAGAGAGG + Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113663041 13:112120109-112120131 GGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1113674084 13:112196204-112196226 AGGAAGGAAGGTAGGGAAAGAGG - Intergenic
1113891495 13:113737932-113737954 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1114893296 14:26952870-26952892 TTGTTGGAATGGAGGCAGAGAGG + Intergenic
1114920046 14:27314649-27314671 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1115071483 14:29328224-29328246 AGGAAGGAAGGGAGGGAAATGGG + Intergenic
1115212719 14:30983998-30984020 GTCTAGGAAGGGAAGGAGAGTGG + Intronic
1115421484 14:33199729-33199751 GGGGAGGAAGGGAGGGAAAGAGG - Intronic
1115587536 14:34829589-34829611 TTGTAGGAATGGTAGGGAAGTGG - Intronic
1115720048 14:36150661-36150683 TTCTAAGAAAGGAGGGAAAATGG - Intergenic
1115746310 14:36441292-36441314 TTTGAGGAAGAGAGGGAAAATGG + Intergenic
1115749323 14:36472848-36472870 TTGGAGGGAGGGAAGGAAGGGGG + Intergenic
1116537284 14:46048416-46048438 TTGGAGGAAGGAAAGAAAAGTGG - Intergenic
1117077253 14:52116987-52117009 TCTTAGGATGGGTGGGAAAGAGG - Intergenic
1117286667 14:54292018-54292040 TTGGCGGAAGGGAGGGGAGGAGG - Intergenic
1117531119 14:56661509-56661531 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1117531133 14:56661545-56661567 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1117604682 14:57415793-57415815 TTGGAGGGAGGGAGGGAGGGAGG - Exonic
1117623100 14:57608203-57608225 TTGACGGAGGGGAGGGAGAGTGG - Intronic
1117723848 14:58652885-58652907 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1117772389 14:59147410-59147432 TTGTAACATTGGAGGGAAAGAGG - Intergenic
1117997236 14:61489289-61489311 TTGAGGGAGGGGAGGGAGAGAGG + Intronic
1118604108 14:67490596-67490618 TTATAGGAAAGGAGAGAAAATGG - Intronic
1118701416 14:68437579-68437601 AGGCAGGAATGGAGGGAAAGGGG - Intronic
1118808157 14:69255510-69255532 TGGAAGGAAGGGAGAGGAAGAGG - Intergenic
1119182774 14:72615592-72615614 TGGGTGGAAGGGAGGGAAGGAGG - Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1119505968 14:75173350-75173372 CTGGAGGGAGGGAGGGAGAGAGG + Intronic
1119818593 14:77593813-77593835 TGGAAGGAGGTGAGGGAAAGTGG - Intronic
1119922195 14:78456920-78456942 AGGGAGGAAGGGAGGGAGAGAGG - Intronic
1119996271 14:79257157-79257179 TTGAAGGCAGGGAGGGCGAGGGG + Intronic
1120016050 14:79474813-79474835 AAGAAGGAAGAGAGGGAAAGAGG + Intronic
1120020984 14:79529727-79529749 TTGTAGAAAAGGATGTAAAGTGG + Intronic
1120299713 14:82691339-82691361 TTGGAGGAAGCTGGGGAAAGTGG - Intergenic
1120319888 14:82946115-82946137 TTGGAGGAGGGGAGAGGAAGAGG - Intergenic
1120426759 14:84358157-84358179 TGGTAGGAAGGAAGGGAGTGGGG + Intergenic
1120575508 14:86175736-86175758 ATGGAGGAAGGGAGGGAGGGAGG + Intergenic
1120677903 14:87443361-87443383 TGGGAGGAAGGGAGGGAGGGGGG + Intergenic
1120747223 14:88163377-88163399 TGAAAGGAAGGGAGGGAAGGAGG + Intergenic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1120852070 14:89180427-89180449 TTCTAAGAAGGCAGGGTAAGAGG - Intronic
1121009741 14:90512828-90512850 TTGGAGGAAGGGAGTCAGAGGGG + Intergenic
1121800255 14:96768854-96768876 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1121971340 14:98359259-98359281 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
1122254265 14:100465066-100465088 TCCTAGGAAGGGAGGGAAAGGGG - Intronic
1122359459 14:101150903-101150925 GAGAAGGAAGGGAGGGAGAGAGG - Intergenic
1122363878 14:101183131-101183153 GGGTAGGCAGGGAGGGAAAGAGG - Intergenic
1122422309 14:101585243-101585265 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1122761612 14:104032947-104032969 TTGGAGGAAGAGAGGGGAGGTGG + Intronic
1123130364 14:105980906-105980928 ATGTATGAATGGAGGGGAAGTGG - Intergenic
1202921509 14_KI270723v1_random:33373-33395 TAGGAGGGAGGGAGGGACAGAGG + Intergenic
1123802703 15:23838160-23838182 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1124211915 15:27770757-27770779 TGGAAGGGAGGGAGGGAGAGAGG - Intronic
1124424743 15:29554373-29554395 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
1124788996 15:32709001-32709023 GGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1125138063 15:36367248-36367270 ATGAAGGGAGGAAGGGAAAGAGG - Intergenic
1125164563 15:36687021-36687043 TAGAAGGAAGGGAGGGAGGGAGG + Intronic
1125197824 15:37068860-37068882 TTGTAGGCAGATAGTGAAAGTGG - Intronic
1125251540 15:37710929-37710951 TGGAAGGAAAGGAGGAAAAGAGG - Intergenic
1126167645 15:45667061-45667083 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1127222408 15:56893550-56893572 TTGGAGGATGGGAGGAAAAGAGG - Intronic
1127238711 15:57086689-57086711 TTTTTTAAAGGGAGGGAAAGAGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127340468 15:58038117-58038139 AAGTAGGGAGGGAGGGGAAGAGG - Intronic
1127501593 15:59558959-59558981 CTGTAGGAAAGAAGGGATAGTGG - Intergenic
1127560562 15:60132436-60132458 AGGCAGGAAGGGAGGGAAAGAGG + Intergenic
1127672238 15:61206242-61206264 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
1127924962 15:63530282-63530304 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1128147252 15:65338628-65338650 TATAAGGAAGGGAGGGAAGGAGG - Intronic
1128915922 15:71562374-71562396 TGGTAGGAAGGGAAGGGAAGGGG + Intronic
1129026527 15:72580070-72580092 GGGTAGGAAGGGAGGGAATGGGG - Intronic
1129165690 15:73775958-73775980 TGGAAGGAAAGGAGGGACAGAGG - Intergenic
1129315835 15:74743304-74743326 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1129702881 15:77777950-77777972 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1129765577 15:78164244-78164266 GAAGAGGAAGGGAGGGAAAGTGG - Intronic
1129892796 15:79082634-79082656 GTGGAGGAAGAGAGGGACAGAGG + Intronic
1129899563 15:79136071-79136093 TTGGAGGAACGGAGGGAGGGAGG - Intergenic
1129949194 15:79571253-79571275 ATGTAGAGAGGGAGGGAAGGGGG - Intergenic
1129990612 15:79959313-79959335 TTGGAGGAAGAGAAGGAAAAAGG + Intergenic
1130036020 15:80362330-80362352 ATGAAGGAAGGGAGGTAAAAAGG + Intronic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1130375959 15:83328688-83328710 TTTTTGGAAGGAAGGGAATGAGG + Intergenic
1130559745 15:84948600-84948622 CTGCAGTAAGGGAGGGAATGAGG - Intergenic
1130680554 15:85992549-85992571 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1130680563 15:85992573-85992595 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1130726250 15:86442575-86442597 TTGAATGAAGGAAGAGAAAGCGG - Intronic
1130924650 15:88375867-88375889 TTGTAGAAAGGGAGGAAGGGGGG - Intergenic
1130982881 15:88824930-88824952 TGATAGGGAGGGAGGGATAGGGG + Intronic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131306868 15:91252731-91252753 ATGAAGGAAGGGAAGGAAGGAGG - Intronic
1131330642 15:91496048-91496070 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131460045 15:92611291-92611313 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1131488074 15:92838614-92838636 TTGTTGGAAGGTTGGGACAGTGG - Intergenic
1131588573 15:93722527-93722549 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
1131737063 15:95344920-95344942 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1131850731 15:96540944-96540966 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1131925907 15:97383488-97383510 ATGAAGGAAGGGAAGAAAAGAGG + Intergenic
1131965395 15:97836694-97836716 TTCTAGGAACTCAGGGAAAGTGG - Intergenic
1131978113 15:97966077-97966099 AAGGAGGAAGGGAGGGAAGGAGG - Intronic
1132390134 15:101432668-101432690 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1132399296 15:101495738-101495760 AGGTAGGGAAGGAGGGAAAGGGG + Intronic
1132422645 15:101686539-101686561 TAATAGGTAGGGAGGGAGAGAGG - Intronic
1132428416 15:101740966-101740988 TTCTAGGGAAGGAAGGAAAGTGG - Intronic
1132630406 16:914568-914590 TCATGGGAAGGGAGGGAAAGAGG - Intronic
1132881988 16:2166375-2166397 TAATAGGAAGGGAGGGAGAGTGG + Intronic
1132946499 16:2534438-2534460 TGGTAGGAATGCAGAGAAAGGGG - Intergenic
1132969211 16:2677195-2677217 TGGTAGGAATGCAGAGAAAGGGG + Intergenic
1133326869 16:4947245-4947267 ATGGAGGAAGGGAGGGAGAGAGG - Intronic
1133551172 16:6855842-6855864 AGAAAGGAAGGGAGGGAAAGAGG - Intronic
1133594049 16:7273165-7273187 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1133647779 16:7780618-7780640 AAGAAGGAAGGGAGGGAGAGAGG - Intergenic
1133839468 16:9394648-9394670 AGGCAGGAAGGGAGGGAGAGTGG - Intergenic
1133839492 16:9394728-9394750 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1133978141 16:10614947-10614969 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1134052548 16:11146759-11146781 TGGGAGGGAGGGAGGGAGAGAGG + Intronic
1134134963 16:11671870-11671892 TGGCAGGCAGGGAGGGAAGGGGG - Intronic
1134246822 16:12546240-12546262 TTGTACGAAGGGTCGAAAAGAGG - Intronic
1134287986 16:12879148-12879170 AGGGAGGAAGGGAGGAAAAGAGG - Intergenic
1134459083 16:14416120-14416142 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1134461712 16:14435209-14435231 TTGTAGGAAGGGAGAGGAGCAGG + Intergenic
1134772227 16:16819300-16819322 TTGAGGGGAGGGAGGGAGAGAGG - Intergenic
1135156495 16:20057553-20057575 ATGGAGGAAGGGAGGGAGGGAGG - Intronic
1135595294 16:23737646-23737668 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1135604373 16:23810460-23810482 TAGGAGAAAGGGAGGGATAGGGG + Intergenic
1135872796 16:26166304-26166326 GAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1135945191 16:26859030-26859052 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1136092250 16:27928872-27928894 TTGTAAGGAGGGAAGCAAAGAGG - Intronic
1136279579 16:29200185-29200207 ATGGATGGAGGGAGGGAAAGAGG - Intergenic
1136290146 16:29266827-29266849 TTGGAGGGAGGGAAGGAGAGAGG + Intergenic
1136352961 16:29723320-29723342 TTGAAGGAAAGGAGAGATAGAGG - Intergenic
1136634809 16:31513947-31513969 AAGAAGGAAGGGAGGGAGAGAGG - Intergenic
1137056122 16:35747423-35747445 TTGCAATAAGAGAGGGAAAGCGG - Intergenic
1137316626 16:47331316-47331338 AAGGAGGAAGGGAGGGACAGAGG + Intronic
1137486915 16:48899148-48899170 TTTTAGAAAGGAAGGGAATGAGG + Intergenic
1137558011 16:49484787-49484809 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137577996 16:49616330-49616352 TAGCAGGGAGGGAGGGGAAGTGG + Intronic
1137637796 16:50002247-50002269 TTAAAGGAAGGGTGGAAAAGAGG - Intergenic
1137746856 16:50828571-50828593 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137842574 16:51653677-51653699 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137950577 16:52779782-52779804 TTGTAGGGAGGTGGGGAAAGAGG + Intergenic
1138044338 16:53705136-53705158 TTGAGGGAAGGGAGAGAAGGTGG - Intronic
1138174378 16:54883405-54883427 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1138174397 16:54883462-54883484 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1138183965 16:54962447-54962469 TTGAAGAAAGGGAGGGAGGGAGG - Intergenic
1138339876 16:56281607-56281629 GAGGAGGAAGGGAGGGAGAGAGG - Intronic
1138656453 16:58494395-58494417 TGGAAGGAAGGGAGGGAAGGGGG - Intronic
1138816551 16:60209570-60209592 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1138895960 16:61205062-61205084 TTGTAGGAAGACAGTGCAAGTGG + Intergenic
1138966381 16:62089150-62089172 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1139209979 16:65067849-65067871 TTGGAGAAAGGGAGGGAGAAAGG + Intronic
1139209987 16:65067873-65067895 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
1139398229 16:66658214-66658236 AGGTAGGGAGGGAGGGAAGGAGG + Intronic
1139399206 16:66666914-66666936 TTGGAGGGAGGGAGGGAGTGAGG + Intronic
1139700411 16:68704582-68704604 CTGCAGGGAGGGAGGGAGAGAGG + Intronic
1139711553 16:68780158-68780180 TTGCTGGAAGGGAGGGAAGGAGG - Intronic
1139760387 16:69180213-69180235 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1139949202 16:70660990-70661012 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1140228389 16:73097047-73097069 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1140286708 16:73609674-73609696 AAGAAGGAAGGAAGGGAAAGAGG + Intergenic
1140598284 16:76442145-76442167 TAGGAGGCAGGGAGGGAGAGAGG + Intronic
1140697765 16:77551833-77551855 TGGGAGGAAGGGAGAGAGAGAGG + Intergenic
1140845074 16:78879047-78879069 TGGAAGGAAGGGAGGAAAGGAGG + Intronic
1140845080 16:78879063-78879085 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
1140906702 16:79415379-79415401 AGCAAGGAAGGGAGGGAAAGAGG + Intergenic
1140957466 16:79878575-79878597 TTGTAAAAAGAGAGGGAGAGGGG - Intergenic
1141148607 16:81549102-81549124 TAGTAGGTAGTCAGGGAAAGGGG + Intronic
1141234587 16:82203700-82203722 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1141241914 16:82272705-82272727 TTGTGGTAAGGAAGGGATAGGGG + Intergenic
1141713937 16:85716355-85716377 GAGGAGGAAGGGAGGGAAGGAGG + Intronic
1141714035 16:85716695-85716717 GAGGAGGAAGGGAGGGAGAGGGG + Intronic
1141728998 16:85809453-85809475 CTGTAGCCAGGAAGGGAAAGGGG + Intergenic
1141799574 16:86297725-86297747 GAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1141803118 16:86324261-86324283 TTTTAGGGAGGGAAAGAAAGAGG + Intergenic
1141952016 16:87345341-87345363 TGGGAGGGAGGGAGGGGAAGAGG + Intronic
1142161518 16:88560154-88560176 CTCCAGGAAGGGAGGGACAGTGG - Intergenic
1142446242 16:90140164-90140186 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1203143361 16_KI270728v1_random:1783621-1783643 GAGAAGGAAGGGAAGGAAAGAGG - Intergenic
1203143393 16_KI270728v1_random:1783743-1783765 AGGAAGGAAGGAAGGGAAAGAGG - Intergenic
1203143423 16_KI270728v1_random:1783840-1783862 AGGAAGGAAGGAAGGGAAAGAGG - Intergenic
1142461263 17:95299-95321 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1142642736 17:1294152-1294174 TTCTAGGGAGGGAGGGACACAGG + Intronic
1142972380 17:3621562-3621584 GGAAAGGAAGGGAGGGAAAGAGG - Intronic
1143050919 17:4125124-4125146 TTGTAGGATGTAAGGGAAGGGGG - Intronic
1143173087 17:4941180-4941202 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1143275699 17:5708189-5708211 TGGGAGGAAGAGAAGGAAAGTGG - Intergenic
1143527602 17:7481573-7481595 TTTTAGGAAAGGAGGGGAAATGG - Intronic
1143627023 17:8116352-8116374 TAGTAGTAGGGGAGGGAATGGGG + Intronic
1143772393 17:9177040-9177062 TTCTAGGAAGGGAGGCAATCAGG - Intronic
1143934571 17:10469547-10469569 TTTGAGGAAGGATGGGAAAGAGG + Exonic
1144033720 17:11344932-11344954 TGGTAGGAAAGGTCGGAAAGAGG - Intronic
1144465514 17:15493716-15493738 AGGAAGGGAGGGAGGGAAAGAGG - Intronic
1144561045 17:16320443-16320465 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1144574788 17:16422573-16422595 TGGGAAGAAGGGAGGGGAAGGGG - Intronic
1144593592 17:16546112-16546134 TTTTAGGCAGAGAGGCAAAGGGG + Intergenic
1144995378 17:19264705-19264727 TTGGAGGAAGGGAGAGAGAAAGG + Intronic
1145408333 17:22631141-22631163 TTGTGGGACAGGAGGGAATGGGG - Intergenic
1145779290 17:27551768-27551790 CTGGAGGCAGGGAGGGAGAGAGG - Intronic
1146010997 17:29194304-29194326 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146086366 17:29833806-29833828 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1146086394 17:29833883-29833905 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1146367319 17:32238965-32238987 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1146374896 17:32287427-32287449 TTGTAGGCATGGAGAGAATGGGG + Intronic
1146493915 17:33303584-33303606 ATGGAGGAAGGGAGACAAAGGGG - Intronic
1146537179 17:33662733-33662755 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1146553146 17:33799296-33799318 AGGCAGGGAGGGAGGGAAAGAGG - Intronic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1147128251 17:38388175-38388197 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1147273145 17:39291347-39291369 TGGTAGGTAGGGAGGGAGGGAGG + Intronic
1147502017 17:40974766-40974788 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1147531092 17:41278539-41278561 TAGAAGGAAGGGAAGGTAAGAGG + Intergenic
1147565408 17:41533273-41533295 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1147565734 17:41535491-41535513 TGGCAGGAGGGGAGGGAAGGGGG + Intergenic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147901580 17:43789779-43789801 TAGAAGGAAGGGAAGGGAAGGGG - Intergenic
1148033814 17:44642544-44642566 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148461462 17:47841200-47841222 TTGGAGGAAGAGAGGGTGAGGGG - Exonic
1148549347 17:48541559-48541581 ATGTGGGAAGGGAAGGAGAGCGG - Intronic
1148675361 17:49441755-49441777 CTGCAGGGAGGGAGGGAGAGGGG - Intronic
1148718983 17:49737137-49737159 TTGCAGGAAGGGTAAGAAAGAGG - Intronic
1148728549 17:49815306-49815328 CTGCAGGAAGGGAGGGGCAGGGG - Intronic
1148767866 17:50049691-50049713 TTGGAGGCAGGGAGGGCAACAGG + Intergenic
1149272406 17:54994658-54994680 ATGTAGGTTGGGAGGGAAATAGG - Intronic
1149276104 17:55039516-55039538 ATCTAGGAAGGGAGTGAAAGTGG + Intronic
1149424459 17:56541848-56541870 TTCAAGGAAGGGAGGGAGGGAGG + Intergenic
1149539810 17:57460449-57460471 AGGAAGGTAGGGAGGGAAAGTGG + Intronic
1149660846 17:58333258-58333280 TTGGAGGAGTGGCGGGAAAGAGG + Intergenic
1149682479 17:58515778-58515800 TGGAAGGAAGGGAGGGAAGGAGG + Intronic
1149682771 17:58517549-58517571 GGGAAGGAAGGGAGGGAAGGAGG + Intronic
1149749348 17:59129967-59129989 AGGGAGGAAGGGAGGGTAAGGGG + Intronic
1150293046 17:63992906-63992928 ATGTAGGAGGGGAAGGAAGGAGG + Intergenic
1150374965 17:64673559-64673581 AGGAAGAAAGGGAGGGAAAGAGG + Intergenic
1150481790 17:65516699-65516721 GTGGAGGAAGGGAGGGTAAAAGG + Intergenic
1150553349 17:66231337-66231359 AGGGAGGAAGGGAGGGAAAAAGG - Intronic
1151078445 17:71301188-71301210 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1151228458 17:72664365-72664387 CAGAAGGCAGGGAGGGAAAGTGG + Intronic
1151229570 17:72674147-72674169 ATGTGGCAAGGGAGGGAAGGAGG - Intronic
1151287381 17:73122679-73122701 TGGTAGGGGGGCAGGGAAAGGGG + Intergenic
1151418250 17:73980881-73980903 TTGTAGGGAGGGAGAGCAACTGG + Intergenic
1151441502 17:74132305-74132327 TTGTGAGGAGGGAGGGAAAGAGG + Intergenic
1151552904 17:74832172-74832194 AGGGAGGAAGGGAGGGACAGAGG - Intronic
1151727628 17:75893855-75893877 GTGGAGGAAGGGAGCGACAGGGG - Intronic
1151825422 17:76521299-76521321 GTGATGGAAGGAAGGGAAAGTGG + Intergenic
1151867821 17:76816031-76816053 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1152397634 17:80044003-80044025 TGGAAGGGAGGCAGGGAAAGAGG + Intronic
1152432550 17:80257328-80257350 TTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1152524689 17:80880905-80880927 TTTCAGGAAGGAAGGGAGAGAGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152638354 17:81439378-81439400 TTGGGGGCAGGGAGGGATAGAGG + Intronic
1152844829 17:82593362-82593384 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153633125 18:7090709-7090731 GAGAAGGAAGGGAGGGAGAGAGG + Intronic
1153687630 18:7562408-7562430 TTGTAGGAAGAGAAGGTAGGAGG - Intergenic
1153786832 18:8543126-8543148 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1153804718 18:8702344-8702366 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1154385116 18:13886349-13886371 GAGAAGGATGGGAGGGAAAGTGG - Intronic
1154975273 18:21451445-21451467 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
1155048394 18:22124804-22124826 TTGTAGGTAGTGATGGAAAGGGG + Intergenic
1155095336 18:22549856-22549878 ATGTGGGAAGGGAGGGAGAGAGG + Intergenic
1155352139 18:24917402-24917424 AGGGAGGCAGGGAGGGAAAGGGG + Intergenic
1155498198 18:26463051-26463073 TTCTCAGAAGGGAGGAAAAGTGG - Intronic
1156063173 18:33106250-33106272 TTGCAGGAAGGAAGGAAAATAGG - Intronic
1156075633 18:33275632-33275654 TTGGAGGAAGGGTAGGAAAGGGG + Intronic
1156623590 18:38882114-38882136 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1156838281 18:41581802-41581824 AGGAAGGAAGGAAGGGAAAGAGG - Intergenic
1156859039 18:41815139-41815161 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1157084541 18:44565791-44565813 AAGAAGGAAGAGAGGGAAAGAGG + Intergenic
1157215857 18:45782914-45782936 ATGGAGGAGGGGAGGGAGAGTGG + Intergenic
1157259759 18:46167808-46167830 TTGTGGGAGGGGTGGGTAAGAGG - Intergenic
1157285910 18:46377294-46377316 TTGAAGGAAGGGAGAGAAAGAGG - Intronic
1157499507 18:48179865-48179887 TTGCAGGAAGGAAGGGAGGGAGG - Intronic
1157570584 18:48709647-48709669 AGGCAGGGAGGGAGGGAAAGAGG + Intronic
1157576678 18:48748355-48748377 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1157581469 18:48776485-48776507 TTGAGGGAGGGGAGGAAAAGGGG - Intronic
1157698081 18:49739650-49739672 TTGAAAGAAAAGAGGGAAAGAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158300538 18:56047227-56047249 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1158311701 18:56166426-56166448 CTATAGGAAGAGAGGGAAGGGGG + Intergenic
1158379121 18:56908806-56908828 TTGAATGATGGGAAGGAAAGAGG - Intronic
1158457542 18:57621561-57621583 TTGCAGGGAGGGAGGGAGGGAGG - Intronic
1158542759 18:58371675-58371697 TTGTATGAAAGGAGAGGAAGAGG + Intronic
1158866119 18:61639055-61639077 TTGTGGGAAGGGGAGGAAAGGGG + Intergenic
1159029630 18:63217989-63218011 AGGAAGGAAGGGAGGGATAGAGG + Intronic
1159067653 18:63588062-63588084 TTGTATGCAGTTAGGGAAAGGGG + Intronic
1159331895 18:67005639-67005661 GTGAAGGAAAGGAGGGAGAGAGG - Intergenic
1159425487 18:68279295-68279317 TTGGAGGAAGGGGGAGGAAGAGG + Intergenic
1159442048 18:68493827-68493849 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1159482034 18:69001873-69001895 TTGTATCAAGGCAGGGAAACTGG - Intronic
1159621669 18:70645805-70645827 TTGTAGCAGGAGAGGAAAAGGGG - Intronic
1159841901 18:73407738-73407760 CTCTAGAAAGGGAGGGAAGGAGG - Intergenic
1159847819 18:73486960-73486982 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1159887914 18:73927090-73927112 TGGTGGGAAGGGTGGCAAAGGGG + Intergenic
1159901194 18:74047653-74047675 GTTTAGGAAGGGAGGGAGAGAGG - Intergenic
1159951877 18:74489999-74490021 ATGTAGGGAGGGAGGGAGGGAGG + Intergenic
1160135274 18:76266250-76266272 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1160242600 18:77133698-77133720 TGTTAGGAAGTGAGGGAGAGGGG + Intergenic
1160265379 18:77337287-77337309 TTGGAGAAAGGGAGGGGACGGGG - Intergenic
1160295022 18:77630008-77630030 TGGGAGGAAAGGAGGGAAGGAGG - Intergenic
1160650964 19:227666-227688 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1160950430 19:1664307-1664329 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
1161186431 19:2924449-2924471 TTGTATGATGGGAGGGAAGCTGG - Intergenic
1161756590 19:6138494-6138516 GGGGAGGGAGGGAGGGAAAGAGG + Intronic
1161756651 19:6138715-6138737 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1161856990 19:6771826-6771848 AGAAAGGAAGGGAGGGAAAGAGG + Intergenic
1161905181 19:7151233-7151255 ATGGAGGGAGGGAGGGAAAGAGG - Intronic
1162094870 19:8304288-8304310 TTGTAGGAAGGTAGAGCTAGTGG - Intronic
1162157784 19:8691409-8691431 TGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1162178524 19:8849697-8849719 GAGGAGGAAGGGAGGGAGAGAGG - Intronic
1162448807 19:10741917-10741939 AAGAAGGGAGGGAGGGAAAGAGG - Intronic
1162549744 19:11351767-11351789 TTGTAGAAGGGGAGGGGAAAAGG + Intronic
1162995874 19:14334701-14334723 ATGAAGGAAGACAGGGAAAGTGG - Intergenic
1163023222 19:14495025-14495047 TTGGAGAGAAGGAGGGAAAGAGG + Intronic
1163137266 19:15321288-15321310 AGGAAGGAAGGAAGGGAAAGAGG + Intronic
1163279682 19:16307952-16307974 TTGAAGGAGGGGAGGGACAGGGG + Intergenic
1163351154 19:16777426-16777448 GGGAAGGAAGGGAAGGAAAGGGG + Intronic
1163383538 19:16985230-16985252 ATGGATGAAGGGAGGGATAGAGG + Intronic
1163473985 19:17514426-17514448 GGGAAGGAAGGGAGGGAAGGAGG - Intronic
1163477109 19:17532857-17532879 AGGGAGGAAGGGAGGGAAAGGGG + Intronic
1163482245 19:17563886-17563908 TTGTAAAAAGAGAGAGAAAGGGG - Intronic
1163591803 19:18198041-18198063 TTTTAGGAAGGAAGGGCAGGAGG - Intronic
1164149696 19:22540755-22540777 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1164462066 19:28457476-28457498 TTGCAGGGAGGAAGGAAAAGGGG - Intergenic
1164731021 19:30504495-30504517 AGGGAGGAAGGGAGGGAAGGTGG - Intronic
1164744224 19:30599351-30599373 GAGGAGGAAGGGAGGGAAGGAGG - Intronic
1164780814 19:30890504-30890526 TTATAGGAAGTAAGGGGAAGAGG + Intergenic
1164925623 19:32127777-32127799 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1164925628 19:32127793-32127815 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1164975629 19:32570953-32570975 AGGTAGGAAGGGAGGGAAGGAGG - Intergenic
1165262601 19:34633610-34633632 TGCCAGGGAGGGAGGGAAAGAGG + Intronic
1165438267 19:35808784-35808806 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1165463536 19:35958816-35958838 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1165670281 19:37672419-37672441 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1165855492 19:38877468-38877490 GTGTGGGAAGGGAGGAAGAGGGG - Intronic
1166050681 19:40257063-40257085 AGGCAGGAAGGGAGGGAGAGAGG + Intronic
1166205708 19:41267442-41267464 TTGTAGCAAGTAAGGGAGAGAGG - Intronic
1166342004 19:42143668-42143690 TTGGAGGAAGTGAGTGAAGGGGG - Intronic
1166350322 19:42194992-42195014 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
1166387826 19:42391841-42391863 TTGGAGGGAGGGAGGGAGGGAGG - Intergenic
1166407177 19:42529336-42529358 TTGGAGCAAGGGATGGAAAGTGG + Intronic
1166872231 19:45877646-45877668 CTGCAGGATGGGAGGGATAGCGG + Intergenic
1166886780 19:45966283-45966305 TTGGAGGAAGGGAAGGAAGAAGG - Intronic
1167206462 19:48105826-48105848 TGGAAGGAAGGGAGGGAGGGAGG - Intronic
1167508100 19:49881753-49881775 TTGTTGGAACGTGGGGAAAGAGG - Intronic
1167742809 19:51334408-51334430 TTCTGGGAGGGGAGGGACAGTGG - Intronic
1168075477 19:53978865-53978887 GGGTAGGGAGGGAGGGAAGGAGG + Intronic
1168143973 19:54408728-54408750 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1168503904 19:56916769-56916791 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
924979645 2:207706-207728 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
925013567 2:504421-504443 GGGGAGGAAGGGAGGGAAGGAGG - Intergenic
925191668 2:1889715-1889737 ATGGAGGGAGGGAGGGAGAGAGG - Intronic
925356687 2:3246818-3246840 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
925356693 2:3246834-3246856 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
925356699 2:3246850-3246872 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
925431053 2:3793577-3793599 TTGTATGAATGGAGGGGAAATGG + Intronic
925480188 2:4261871-4261893 TTATAGAAAAGAAGGGAAAGAGG + Intergenic
925783174 2:7402697-7402719 ATGGAGGAAGGGAGAGAAAGAGG + Intergenic
926149201 2:10415371-10415393 TTATGGGAAGGGAGGGATGGGGG - Intronic
926157324 2:10463856-10463878 TTATAGGGAGGGAGGGAGGGAGG - Intergenic
926312482 2:11684734-11684756 TGGAAGGAAGGGAGGGAGGGAGG - Intronic
926379557 2:12272365-12272387 TTGGAGGAGGGGATGGAAATAGG + Intergenic
926705869 2:15837054-15837076 CTGGAGGGAGGGAGGGAATGGGG + Intergenic
926937228 2:18098171-18098193 TGCTAAGAAGGGAGGGAGAGAGG - Intronic
926950483 2:18237316-18237338 GTGTAGGAAGGTAGGTAAAGAGG + Intronic
927107065 2:19836901-19836923 TAGAAGGAAGGAAGGGAGAGAGG - Intergenic
927151493 2:20198863-20198885 TTGTAGGATGGGTGGGGAGGAGG - Intergenic
927158543 2:20236451-20236473 GGGAAGGAAGGGAGGGAGAGAGG - Intergenic
927350370 2:22105523-22105545 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
928070307 2:28208604-28208626 AGGGAGGGAGGGAGGGAAAGGGG - Intronic
928092345 2:28382756-28382778 ATGAAGAAAGGGAGGGAAGGTGG - Intergenic
928176422 2:29037115-29037137 TGATGGGCAGGGAGGGAAAGTGG + Intronic
928266648 2:29817662-29817684 ATGGAGGAAGGGAGGGACGGAGG - Intronic
928276493 2:29905621-29905643 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
928320415 2:30278837-30278859 TTGTTGGAAAGGAGAGGAAGGGG - Intronic
928697600 2:33865490-33865512 TGGGGGGAAGGGAGGGAAACAGG + Intergenic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
929524281 2:42685845-42685867 TTATAAGTATGGAGGGAAAGAGG - Intronic
929610412 2:43266768-43266790 TTGTGGGAAAGGAGGGCATGGGG + Intronic
930083804 2:47477905-47477927 TGGGAGGGAGGGAGGGAAGGAGG - Intronic
930262788 2:49166688-49166710 GAGGAGGAAGGGAGGGAGAGAGG + Intergenic
930352664 2:50277444-50277466 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
930356481 2:50327618-50327640 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
930847776 2:55923824-55923846 GAGGAGAAAGGGAGGGAAAGGGG + Exonic
931077697 2:58735005-58735027 TTATAGACAGGGAGGGAGAGAGG - Intergenic
931217692 2:60261881-60261903 GGGTTGGAAGGGTGGGAAAGGGG - Intergenic
931264635 2:60649817-60649839 TTGGAGGGAGGGAGGGAGGGAGG + Intergenic
931554913 2:63491895-63491917 TTGGAAGATGGGAGGGAAAGAGG - Intronic
931614837 2:64144885-64144907 TTGAGGGAAGTGAGGGACAGAGG - Intergenic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931909176 2:66876334-66876356 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
931925346 2:67066301-67066323 GTGTGGCATGGGAGGGAAAGTGG - Intergenic
932120115 2:69090994-69091016 TTGTTGGTGGGGTGGGAAAGAGG + Intronic
932407290 2:71521990-71522012 GCGGAGGAAGGGAGGGAAGGTGG - Intronic
932464046 2:71902024-71902046 GTGAAGGAAGGGAGGGAGGGAGG - Intergenic
932547026 2:72723327-72723349 AGGGAGGAAGGCAGGGAAAGAGG + Intronic
933027323 2:77276371-77276393 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
933069315 2:77836998-77837020 GAGTAGGAAGGGAGGAAGAGAGG + Intergenic
933234480 2:79850156-79850178 ATGGAGGAAGGGAGGGTAGGAGG - Intronic
933430099 2:82165457-82165479 TGGAAGGAAGGAAGGGAAGGAGG - Intergenic
933794082 2:85906197-85906219 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
933974998 2:87502255-87502277 TAGATGGAAGGAAGGGAAAGAGG + Intergenic
934048370 2:88190339-88190361 TTGTAGGAAGAAAGTGAGAGTGG + Intergenic
934082135 2:88477861-88477883 GAGGAGGAAGGGAGGGAGAGAGG - Intergenic
934124184 2:88870627-88870649 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
935173702 2:100629722-100629744 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
935187756 2:100749373-100749395 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
935445852 2:103155763-103155785 TTGTGGGAAGGGGGAGAAACAGG - Intergenic
935655482 2:105419353-105419375 TTGGAGAAAGGGTGGGAAGGGGG - Intronic
935716979 2:105947914-105947936 AAGAAGGAAGGGAGGGACAGAGG + Intergenic
935741479 2:106152476-106152498 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
935825366 2:106942601-106942623 TTGGAAGAAGGCAGGAAAAGAGG + Intergenic
936318828 2:111448558-111448580 TAGATGGAAGGAAGGGAAAGAGG - Intergenic
936454879 2:112665408-112665430 TTGAGGGAAGGGAGGGTAGGGGG + Intergenic
936508430 2:113126689-113126711 TGGAAGGAAGGAAGGGAAAGAGG - Intronic
936616890 2:114057193-114057215 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
936870336 2:117129023-117129045 TTCAAGGAAGAGAGGAAAAGGGG - Intergenic
936894160 2:117407893-117407915 GGGAAGGAAGGGAGGGAAGGAGG - Intergenic
937024997 2:118690518-118690540 AGGAAGGAAGGGAGGGAAAGAGG + Intergenic
937034541 2:118769852-118769874 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
937072297 2:119073417-119073439 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
937107591 2:119332620-119332642 TTCTAGGAAGGGAGTAACAGTGG - Intronic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937843663 2:126553718-126553740 TTGAAGGAAGGGGGAGAAGGAGG + Intergenic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938277672 2:130040957-130040979 TTGTTGGAAAGGAAGTAAAGAGG - Intergenic
938328634 2:130431760-130431782 TTGTTGGAAAGGAAGTAAAGAGG - Intergenic
938361311 2:130689734-130689756 TTGTTGGAAAGGAAGTAAAGAGG + Intergenic
938437714 2:131296424-131296446 TTGTTGGAAAGGAAGTAAAGAGG + Intronic
938554155 2:132408647-132408669 AAGGAGGAAGGGAGGGAGAGGGG + Intergenic
938701783 2:133886016-133886038 TGGGAGGAAGGAAAGGAAAGGGG - Intergenic
938872426 2:135494115-135494137 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
939067751 2:137505007-137505029 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
939133846 2:138271450-138271472 TTTTAGGCAGAGAGGAAAAGGGG + Intergenic
939240417 2:139551678-139551700 TTAGCTGAAGGGAGGGAAAGAGG - Intergenic
939350626 2:141033203-141033225 TGGAAGGGAGGGAGGGAAGGTGG + Intronic
939825927 2:147015522-147015544 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
939875046 2:147568287-147568309 ATGGAGGGAAGGAGGGAAAGAGG + Intergenic
940492229 2:154377427-154377449 AGGTAGGAAGGGAGGGAGGGAGG + Intronic
940576560 2:155513485-155513507 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
940997488 2:160165513-160165535 TTGCAGCGAGGGAGGAAAAGAGG - Intronic
941336054 2:164245112-164245134 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
941569223 2:167148502-167148524 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
941587895 2:167382462-167382484 AAGGAGGAAGGGAGGGAGAGAGG - Intergenic
941848117 2:170151620-170151642 ATGGAGGAAGGAAGGGAGAGAGG + Intergenic
942015568 2:171810609-171810631 TTGTAATAAGGGAGGGAATTTGG - Intronic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942305730 2:174605692-174605714 ATATAGAAAAGGAGGGAAAGTGG + Intronic
942399338 2:175584855-175584877 TTGTAGGACCGGAGGGGAAAAGG - Intergenic
942709546 2:178817802-178817824 TTGAAAGAAGGGAGGGAGGGAGG - Intronic
942919381 2:181352676-181352698 TAGTAGGAAGGGAGGGTGGGAGG + Intergenic
943012479 2:182467129-182467151 ATGAAAGAAGGGAGGGAGAGAGG + Intronic
943060963 2:183040821-183040843 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
943153373 2:184142416-184142438 TGGGAGGGAGGGAGGGACAGAGG + Intergenic
943543860 2:189250547-189250569 TTCAAGTAAGGGAGGGAAGGAGG - Intergenic
943687553 2:190834772-190834794 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
944089409 2:195889270-195889292 TGGAAGGAAGGGAGGGAGGGAGG - Intronic
944177651 2:196850710-196850732 AGGGAGGAAGGGAGGGAAAGAGG + Intronic
944725850 2:202470459-202470481 TTGTAAGAAAGTAAGGAAAGAGG + Intronic
944737119 2:202577252-202577274 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
944927414 2:204479405-204479427 TTAAAGGAAGAAAGGGAAAGGGG - Intergenic
944927898 2:204484022-204484044 TGGTAGGATGTGAAGGAAAGTGG + Intergenic
945133590 2:206601191-206601213 TTGTAAGAAGGAAGAGAAACTGG + Intronic
945269107 2:207921038-207921060 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
946058562 2:216921498-216921520 TTGTAGGAGGGGATAGAATGAGG - Intergenic
946115790 2:217460904-217460926 TTGTAAAAGTGGAGGGAAAGAGG + Intronic
946140322 2:217684800-217684822 GGGAAGGAAGGAAGGGAAAGAGG + Intronic
946521233 2:220467300-220467322 TTGTAGGGAGGGAGGGATTTCGG + Intergenic
946643488 2:221808813-221808835 AAAAAGGAAGGGAGGGAAAGTGG + Intergenic
946996266 2:225395513-225395535 TGGGAGGGAGGGAGGGAAGGAGG - Intergenic
947077684 2:226363836-226363858 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
947077694 2:226363860-226363882 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
947077761 2:226364022-226364044 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
947224464 2:227826555-227826577 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
947228439 2:227862020-227862042 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
947272138 2:228348071-228348093 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
947477270 2:230461517-230461539 ATGGAGGCAGGAAGGGAAAGGGG + Intronic
947504739 2:230699167-230699189 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948080327 2:235200334-235200356 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
948287103 2:236794484-236794506 TTGTTGGAAATGTGGGAAAGGGG + Intergenic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948582639 2:238998287-238998309 ATGAAGGAAGGGAGAGAAGGAGG - Intergenic
948751820 2:240137487-240137509 TTGGAGGAAGAGAGGGAGAGAGG + Intergenic
1168744051 20:221281-221303 TGGAAGGAAGGGAGGGAGGGAGG + Intergenic
1168878616 20:1187111-1187133 TTGAAGGAAGTGAGGGAAGGGGG - Intronic
1169195230 20:3679232-3679254 ATCCAGGGAGGGAGGGAAAGAGG + Intronic
1169510176 20:6255490-6255512 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1169574068 20:6938931-6938953 AAGAAGGAAGAGAGGGAAAGAGG - Intergenic
1169584967 20:7071205-7071227 GACTAGGAAGGGAGGGACAGAGG + Intergenic
1169705821 20:8503544-8503566 TAATAGGAAGGGAAGGAAAAAGG - Intronic
1169714691 20:8601940-8601962 GTGCTGCAAGGGAGGGAAAGAGG - Intronic
1169748065 20:8963459-8963481 GTGTAGGGAGTGAGGCAAAGAGG + Intronic
1169766729 20:9154855-9154877 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1169975965 20:11328291-11328313 AGATAAGAAGGGAGGGAAAGAGG + Intergenic
1170301685 20:14890994-14891016 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
1170316664 20:15049272-15049294 GGGTAGGAAGGGAAAGAAAGAGG + Intronic
1170332487 20:15229134-15229156 TTTTAGGAATGTAGTGAAAGGGG - Intronic
1170561600 20:17563357-17563379 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
1170950999 20:20936032-20936054 TTGTAGGGGGTGAGGGATAGAGG - Intergenic
1171025169 20:21623736-21623758 GGGAAGGAAGGGAGAGAAAGAGG - Intergenic
1171030004 20:21668847-21668869 TTGTAGAAGGGGAGGGAAGGAGG + Intergenic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1171202668 20:23254639-23254661 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1171327428 20:24307659-24307681 GTGTAGGACTGCAGGGAAAGAGG - Intergenic
1171820192 20:29828870-29828892 CTTAAGGAAGGGAGGTAAAGGGG + Intergenic
1172123577 20:32612450-32612472 TCTTTGGAAGGGAGGGAAATTGG - Intergenic
1172298710 20:33832607-33832629 TTCTAGGAAGGGAGTGACTGAGG - Intronic
1172476437 20:35241772-35241794 TGGTAGGAAGTGAGGAACAGGGG - Intronic
1172882412 20:38210692-38210714 TAGAAGGAAGGGGGGCAAAGCGG - Exonic
1172943531 20:38671085-38671107 TTGCAGGAAGGGAGGGAAAGGGG + Intergenic
1172946317 20:38692473-38692495 GAGGAGAAAGGGAGGGAAAGGGG - Intergenic
1173144216 20:40510866-40510888 AAGGAGGAAGGAAGGGAAAGAGG + Intergenic
1173305241 20:41841362-41841384 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1173483936 20:43426627-43426649 TTGTAGGAAGGAAGGGAGAAAGG + Intergenic
1173530930 20:43769152-43769174 CTATAGAAAGGGAGGGAAGGAGG + Intergenic
1173550226 20:43927772-43927794 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1173681956 20:44888905-44888927 TTGTTGGCAGGGAGGAAATGAGG + Intronic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1173795261 20:45855293-45855315 CTGTAGGGAGAGGGGGAAAGAGG + Intronic
1173823986 20:46035613-46035635 TTGAATGGAGGGAGGGAAAGGGG + Intronic
1173950064 20:46985226-46985248 TTGGAGGAAGGGAGGAAAGAAGG - Intronic
1174178441 20:48659333-48659355 AAGGAGGAAGGGAGGGAAAGAGG + Intronic
1174350954 20:49967615-49967637 GGGGAGGCAGGGAGGGAAAGGGG - Intergenic
1174724311 20:52845330-52845352 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1174952328 20:55055895-55055917 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1175019310 20:55827450-55827472 CTAAAGGAAGGGAAGGAAAGGGG - Intergenic
1175099790 20:56570748-56570770 GGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175291294 20:57877236-57877258 GCGTAGAAAGGGAGGGAGAGGGG + Intergenic
1175341346 20:58232151-58232173 TTGTAGGTAGGGTGGGGCAGGGG + Intergenic
1175479993 20:59304007-59304029 AGGCAGGAAGGGAGGGAAGGAGG - Intronic
1175480029 20:59304123-59304145 TTTCAGGAAGGAAGGGAAGGAGG - Intronic
1175717166 20:61262841-61262863 TGGAAGGAAGGGAGGGAGGGAGG - Intronic
1175831553 20:61967585-61967607 AGGAAGGAAGGGAGGGGAAGGGG - Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176270534 20:64233498-64233520 ATGGAGGAAGGAAGGGAAAAGGG - Intronic
1176286556 21:5021995-5022017 ATGGAAGGAGGGAGGGAAAGTGG - Intergenic
1176388234 21:6150383-6150405 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1176661264 21:9637224-9637246 GGGAGGGAAGGGAGGGAAAGGGG - Intergenic
1176892294 21:14332497-14332519 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1176952037 21:15059522-15059544 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1177046960 21:16182934-16182956 TAGGAGGAAGGGAGGGAAAAAGG - Intergenic
1177078786 21:16612858-16612880 TTGTCAGAAGCGGGGGAAAGGGG - Intergenic
1177149037 21:17436213-17436235 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1177260971 21:18729357-18729379 GTGTAGAAAGGGTGGGGAAGTGG + Intergenic
1177874926 21:26620237-26620259 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
1178043954 21:28673154-28673176 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1178184950 21:30208469-30208491 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1178259479 21:31085616-31085638 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1178307619 21:31503542-31503564 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1178390981 21:32198197-32198219 ATATGGGAAGGGAAGGAAAGAGG + Intergenic
1178741592 21:35206779-35206801 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1178887892 21:36497176-36497198 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1179061441 21:37983114-37983136 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
1179277616 21:39906577-39906599 GGGAAGGAAGGGAAGGAAAGGGG - Intronic
1179735238 21:43387865-43387887 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1179870625 21:44241480-44241502 ATGGAAGGAGGGAGGGAAAGTGG + Intergenic
1179898600 21:44377353-44377375 TTCTTGGGAGGGAGGGAGAGGGG - Intronic
1180093821 21:45545377-45545399 TGGGAGGAGGGGAGGGCAAGGGG - Intergenic
1180324190 22:11353565-11353587 CTTAAGGAAGGGAGGTAAAGGGG + Intergenic
1180966920 22:19794546-19794568 AGGTAGGAAAGGAGGAAAAGTGG + Intronic
1181380319 22:22497160-22497182 TAGGAGGAAGGGAAGGAAAAGGG - Intronic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1181969480 22:26679486-26679508 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1182100785 22:27655999-27656021 ATGGAGGAAGGGAGGGAGAGAGG + Intergenic
1182100859 22:27656311-27656333 ATGGAGGAAGGGAGAGAGAGAGG + Intergenic
1182126081 22:27816815-27816837 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1182377753 22:29860460-29860482 TGGGAGGAAGGGAGGGAGGGAGG - Intergenic
1182402066 22:30086144-30086166 AAGGAGGAAGAGAGGGAAAGGGG - Intronic
1182778996 22:32852441-32852463 TTGTAGGAGGGAAGAGAGAGAGG + Intronic
1183000018 22:34849037-34849059 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1183007651 22:34916646-34916668 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1183009785 22:34935397-34935419 ATGTTGGAAGTGAGGGAGAGAGG - Intergenic
1183085386 22:35483717-35483739 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1183085425 22:35483853-35483875 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1183115175 22:35686246-35686268 TTGTAGGCAGGGGGGCAAGGAGG + Intergenic
1183115586 22:35690050-35690072 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
1183135219 22:35880821-35880843 TGGAAGGAAGGGAGGGAGGGAGG + Intronic
1183214945 22:36473557-36473579 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
1183601316 22:38842256-38842278 TGGAAGGAAGAGAGAGAAAGAGG - Intronic
1183698739 22:39437987-39438009 GTTTGAGAAGGGAGGGAAAGTGG - Intergenic
1183698788 22:39438142-39438164 AGGAAGGAAGGGAGGGAAGGGGG - Intergenic
1184255203 22:43282523-43282545 TGGTAGAAAGAGAGGGCAAGGGG - Intronic
1184421198 22:44383860-44383882 CTGGAGGGAGGGAGGGAGAGAGG + Intergenic
1185037018 22:48484709-48484731 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1185375800 22:50482126-50482148 GTGTAGGGAGGCAGAGAAAGAGG - Intronic
1185415926 22:50710255-50710277 TTGGAGGAAGGGGAGGGAAGGGG + Intergenic
1203237697 22_KI270732v1_random:21802-21824 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
949124526 3:430873-430895 TTCTAGAAATGGAGGGAAAATGG - Intergenic
949269254 3:2195056-2195078 GTGTAGGGAAGGAGGGAATGGGG - Intronic
949328035 3:2889016-2889038 TGGAAGGAAGGGAGGGAGGGAGG + Intronic
949401074 3:3665877-3665899 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
949644220 3:6074844-6074866 ATGGAGGAAGGGAGAGAAAGAGG - Intergenic
949736707 3:7180926-7180948 TTCTAGAAAGGGAGGTAAATCGG - Intronic
949807713 3:7973947-7973969 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
949823315 3:8138664-8138686 AGGAAGGAAGGGAGGGGAAGGGG + Intergenic
950795957 3:15510829-15510851 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
950879971 3:16315642-16315664 TTGTAGAAAGAGATGGCAAGTGG - Intronic
951193523 3:19798468-19798490 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
951426582 3:22553076-22553098 CTGTGGGAAGGGAAGGCAAGGGG + Intergenic
951479828 3:23148517-23148539 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
951553040 3:23894695-23894717 TGGTAGGAGGGGAGTGATAGAGG - Intronic
951615825 3:24542533-24542555 AAGTAGGAAGGGAGGGAGAGAGG + Intergenic
951757348 3:26105490-26105512 TCGGAGGATGGTAGGGAAAGGGG + Intergenic
951765000 3:26188009-26188031 TGGTAGGAAGGGCTGGCAAGGGG - Intergenic
951829369 3:26907306-26907328 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
951829582 3:26911101-26911123 TGGAAAGAAGGGAGGGCAAGAGG - Intergenic
951851237 3:27142541-27142563 TTGTGTGAAGGGAAGAAAAGAGG - Intronic
952163986 3:30725637-30725659 TTCCAGGAAGTGAGGGAGAGAGG - Intergenic
952196350 3:31079458-31079480 TTGTAAGAAGGGAGGGTGAGAGG - Intergenic
952353928 3:32567384-32567406 TTGTAGGAGGAGAGAGAATGTGG + Intronic
952402455 3:32975578-32975600 TAGTAGAAAAGGAGAGAAAGAGG + Intergenic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
953024855 3:39138836-39138858 TTGTGTGGAGGGATGGAAAGTGG + Exonic
953049838 3:39331007-39331029 TGGAAGGAAGAGAGGGAATGAGG + Intronic
953434243 3:42865951-42865973 AAGTAGGAAGGGAGGAAAGGAGG - Exonic
953472656 3:43180161-43180183 TTGTGGGGAGGGAGAGGAAGAGG + Intergenic
953574686 3:44103571-44103593 ATGTAGAATGGGAGGGAGAGGGG + Intergenic
954042246 3:47897581-47897603 TTGAAGTAAGGGAGAAAAAGAGG + Intronic
955107350 3:55911022-55911044 GCGCAGGGAGGGAGGGAAAGGGG - Intronic
955425373 3:58783995-58784017 GTGGTGGAAGGGAGGGAAGGAGG - Intronic
956166720 3:66402923-66402945 TTGAATGAAGGGAGGGACAGAGG - Intronic
956413492 3:69003107-69003129 ATGTAGGTAGGGAGAGAGAGGGG - Intronic
956477917 3:69642871-69642893 TGGGAGGAAGCGAGGGAAGGAGG + Intergenic
956486030 3:69722740-69722762 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
956756532 3:72393406-72393428 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
956968254 3:74489467-74489489 TGGGAAGAAGGGAGGGAGAGAGG - Intronic
957191090 3:77010849-77010871 AGGTAGGGAGGGAGGGAGAGAGG - Intronic
957220849 3:77380692-77380714 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
957350043 3:79012883-79012905 TTGAAGGAAGGGGCTGAAAGTGG + Intronic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
957550176 3:81694239-81694261 GAGGAGGAAGGGAGGGAAAAAGG + Intronic
958019348 3:87978867-87978889 TGGAAGGAAGGGAGGGAGGGAGG + Intergenic
958019382 3:87979001-87979023 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
958555298 3:95667126-95667148 TTGAAGGATGGGAGAGAAAATGG - Intergenic
958632552 3:96701549-96701571 TTGAAAGAAGGAAGGGAATGAGG + Intergenic
958656907 3:97014325-97014347 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
958693399 3:97497383-97497405 TTGGAGGAAGTGAGGGAGTGGGG - Intronic
958927136 3:100171210-100171232 AGGAAGGAAGGAAGGGAAAGAGG - Intronic
959056399 3:101572038-101572060 TAGTATGAAGGGGTGGAAAGGGG - Intergenic
959154018 3:102644210-102644232 TGGTAGGATGGGATGGAAGGAGG - Intergenic
959416635 3:106083959-106083981 ATAAAGGAAGGGAGGGAAGGAGG + Intergenic
959601881 3:108196275-108196297 TTGTAAGGAGGGAAAGAAAGAGG - Intronic
959706150 3:109340604-109340626 ATGAAGGAAGGGAGGAAATGAGG - Intergenic
960223817 3:115147173-115147195 TTGTGGGACGGGCGGGAGAGAGG - Intronic
960303540 3:116033719-116033741 TTGTTGGAAGGAAGGGTCAGTGG - Intronic
960891125 3:122449526-122449548 TAGTACCAAGGGAGAGAAAGTGG + Intronic
960923665 3:122774637-122774659 GTGTGGGAAGGGAGGGCAAGGGG + Intronic
961524467 3:127487724-127487746 TTCAAGGAAGGGAATGAAAGGGG + Intergenic
961635769 3:128331417-128331439 CTTTAGGAAGGGAGGAAGAGGGG - Intronic
961965115 3:130894165-130894187 AGGGAGGAAGGGAGGGAGAGAGG - Intronic
962040723 3:131705038-131705060 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
962042660 3:131723367-131723389 ATGAAGGAAGAGAGGGAAAGGGG + Intronic
962199301 3:133388479-133388501 TGGAAGGAAGGGAGGGAAAGAGG + Intronic
962207889 3:133450079-133450101 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
962228855 3:133641959-133641981 TATTAAGAAGGGAGGGAAGGGGG - Intronic
962340065 3:134575194-134575216 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
962357124 3:134704393-134704415 ATTTAGTAGGGGAGGGAAAGAGG + Intronic
962369201 3:134806669-134806691 TTAGGGGAAGGGTGGGAAAGGGG + Intronic
962502878 3:136012942-136012964 TGGGAGGAAGGGTGGGAAGGGGG - Intronic
962619886 3:137167898-137167920 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
962711685 3:138091654-138091676 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
962789991 3:138802444-138802466 GCGGAGGAAAGGAGGGAAAGAGG + Intronic
962830505 3:139135032-139135054 TTGTAGGAAAGAAGAGAAAAAGG - Intronic
962844158 3:139260607-139260629 TGGAAGGAAGGGAGGGAGGGAGG + Intronic
963108252 3:141664665-141664687 TTGGGGGAAGGAAGGGAGAGAGG - Intergenic
963110213 3:141682331-141682353 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
963343678 3:144068821-144068843 TTGAAGAAAGGGAGGTAGAGAGG - Intergenic
963627397 3:147690629-147690651 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
963774350 3:149423079-149423101 TTGCAGGAAGGGAGAGACATTGG + Intergenic
964014107 3:151925747-151925769 TTATAGGAAGGGAGGGAGAGAGG - Intergenic
964028116 3:152102968-152102990 TTGGAGGAAGGGAGGGAGGAAGG - Intergenic
964108088 3:153060401-153060423 TATCAGGAAGGGAGGGAAGGAGG + Intergenic
964108117 3:153060489-153060511 TTCTAGGAAGGAAGGGAGGGAGG + Intergenic
964878428 3:161396159-161396181 TAGTAGCAAGGGAGAGGAAGTGG - Intergenic
964903872 3:161694045-161694067 AGGGAGGAAGGGAGGGAAAGAGG - Intergenic
964914647 3:161825709-161825731 GAGAGGGAAGGGAGGGAAAGAGG - Intergenic
965026860 3:163313529-163313551 TGGGAGGGAGGGAGAGAAAGAGG - Intergenic
965026881 3:163313617-163313639 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
965186901 3:165476518-165476540 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965186953 3:165476684-165476706 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965421023 3:168458371-168458393 GGGAGGGAAGGGAGGGAAAGAGG - Intergenic
965498944 3:169433583-169433605 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
965562620 3:170076111-170076133 TTGTATCTAGGGAGGGAAACTGG + Intronic
965630121 3:170724528-170724550 TTGGAGGAAAGAAGTGAAAGTGG + Intronic
966076249 3:175938687-175938709 CAGTAGGAAGAGAGAGAAAGAGG - Intergenic
966204772 3:177394848-177394870 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
966270334 3:178097066-178097088 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966446944 3:180011083-180011105 TGATAGAAAGGAAGGGAAAGTGG - Intronic
966569399 3:181424070-181424092 AGGAAGGAAGGAAGGGAAAGAGG + Intergenic
966904888 3:184514882-184514904 TTGTAGGGAGGAAGGCAAGGGGG - Intronic
967350723 3:188511195-188511217 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
967391611 3:188961735-188961757 TGGAAGGAAGGGAGGGAGAAGGG - Intronic
967792752 3:193566539-193566561 TTTTAGGGATAGAGGGAAAGGGG - Intronic
967850360 3:194077762-194077784 TTGGAGGAATGGAGGGATGGAGG + Intergenic
967858873 3:194137225-194137247 TTCCGGAAAGGGAGGGAAAGAGG + Intronic
968005534 3:195240211-195240233 GTGTAGGGAGGAGGGGAAAGAGG + Intronic
968366866 3:198192321-198192343 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
968695033 4:2020220-2020242 AGGTAGGGAGGGAGGGAGAGAGG - Intronic
969283057 4:6184393-6184415 TTCTAGGAAAGGAGGGAAGGCGG - Intronic
969436082 4:7190379-7190401 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
969492529 4:7508181-7508203 ATGTAGGGAGGAAGGGAAGGGGG + Intronic
969508770 4:7605212-7605234 TCGTTGGAAAGGAGGAAAAGGGG + Intronic
969525297 4:7701180-7701202 AAGGAGGAAGGGAGGGAGAGGGG + Intronic
970068531 4:12127831-12127853 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
970559588 4:17269553-17269575 TTGGTGGAAGGAAGGGAAAGGGG - Intergenic
971132457 4:23827800-23827822 TTGTAGAAAAGGAGGAGAAGGGG + Intronic
971361277 4:25940766-25940788 AGGAAGGAAGGGAAGGAAAGGGG - Intergenic
971393694 4:26209602-26209624 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393702 4:26209626-26209648 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393710 4:26209650-26209672 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393727 4:26209698-26209720 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393735 4:26209722-26209744 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393743 4:26209746-26209768 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393761 4:26209795-26209817 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971393779 4:26209844-26209866 AAGGAGGAAGGGAGGGAGAGAGG - Intronic
971400289 4:26269775-26269797 TTGAGGGAAGGGAGTGAAGGGGG + Intronic
972296371 4:37743251-37743273 GTGAAGGAAGGGAGGGCAAAAGG + Intergenic
972351945 4:38244236-38244258 GTGGAGGAAGGGAGGGCAGGAGG - Intergenic
972353074 4:38255102-38255124 ATGGAGGAAAGGAAGGAAAGAGG + Intergenic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972722950 4:41719064-41719086 AAGGAGGAAGGGAAGGAAAGGGG + Intergenic
972924166 4:43983625-43983647 AGGGAGGAAGGGAGGGACAGAGG + Intergenic
973157667 4:46977214-46977236 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
973270609 4:48258894-48258916 GTGTAGGGAAGTAGGGAAAGTGG - Intronic
973299056 4:48559619-48559641 TGGGGGGAAGGGAGGGAGAGAGG + Intronic
973314361 4:48744333-48744355 TTGAAGGAGGGGAAGGAGAGAGG + Intronic
973786192 4:54334965-54334987 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
974022976 4:56707978-56708000 TTGTAGGAATGAAGGAAAGGAGG + Intergenic
974424890 4:61729050-61729072 TTGTAGAGAGGGAGGGAGGGGGG + Intronic
974682709 4:65183771-65183793 CTAAAGGAAGGGAGGGAGAGAGG - Intergenic
974757255 4:66225673-66225695 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
975087456 4:70359618-70359640 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
975156092 4:71074666-71074688 AAGGAAGAAGGGAGGGAAAGAGG + Intergenic
975317393 4:72970250-72970272 TTTTTGGCAGGGAGAGAAAGAGG + Intergenic
975373868 4:73620079-73620101 TTGTAGGGTGGGAGGGAGAGAGG - Intronic
976476688 4:85492091-85492113 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
976561303 4:86504700-86504722 TTGGAGGATGGGGTGGAAAGTGG - Intronic
976703816 4:88000968-88000990 GAGGAGGGAGGGAGGGAAAGGGG + Intergenic
976873158 4:89821265-89821287 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
977037505 4:91973830-91973852 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
977174018 4:93797625-93797647 TTGGAGGAGGGGAGGAAAGGAGG - Intergenic
977178444 4:93842848-93842870 AGGTAAGAAGGGAGGGAAAGGGG + Intergenic
977206927 4:94173589-94173611 TGGGAGGGAGGGAGGGAAAAAGG + Intergenic
977407556 4:96619351-96619373 GTGGAGGAAGGGAGGGATAGTGG - Intergenic
977451659 4:97206750-97206772 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
977634964 4:99286695-99286717 AGGCAGGAAGAGAGGGAAAGAGG + Intronic
977643412 4:99383458-99383480 TTGTGGAATGGGAGGGAAAAAGG - Intergenic
977655216 4:99513657-99513679 AGGAAGGAAGGGAGGGAATGAGG - Intronic
977790944 4:101102271-101102293 AGGGAGGAAGGGAGGGAGAGAGG + Intronic
978071616 4:104479749-104479771 AGGAAGGAAGGGAGGGAGAGGGG - Intronic
978096015 4:104779243-104779265 TTATAGGAAGGAAGAGAATGGGG - Intergenic
978177795 4:105755311-105755333 AAGAAGGAAGGGAGGGAGAGAGG + Intronic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978384558 4:108167333-108167355 GTGTAGGATGGGAGGTAGAGGGG - Intronic
978465985 4:109009804-109009826 TTTTAGGAAGGGGAGGAATGTGG - Intronic
978656139 4:111067718-111067740 TTGCATAAAGGGAGGAAAAGAGG + Intergenic
979255280 4:118601930-118601952 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
979291187 4:118980772-118980794 GTTAAAGAAGGGAGGGAAAGAGG + Intronic
979506425 4:121502669-121502691 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
979506439 4:121502701-121502723 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
979506451 4:121502729-121502751 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
979549002 4:121969238-121969260 TTAAAGGAAGGGAGGGAGGGAGG - Intergenic
979875676 4:125887927-125887949 TTGTAAGAAGTGAAGGAAAAGGG - Intergenic
979920023 4:126484846-126484868 GTGTAGGAATGGTGGTAAAGAGG - Intergenic
979951142 4:126895788-126895810 TTGTAGGAAGAGAGGAATGGAGG + Intergenic
981086512 4:140689586-140689608 TAGGAGGAAGGGAAGAAAAGGGG - Intronic
981183229 4:141770032-141770054 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
981829233 4:148981206-148981228 ATGAAGGAAGGAAGGGAAAATGG - Intergenic
981861239 4:149358959-149358981 GTGCAGGAAAGGAGGGAGAGAGG + Intergenic
982087225 4:151848192-151848214 TTGGGGAGAGGGAGGGAAAGGGG - Intergenic
982256136 4:153453296-153453318 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982708631 4:158737402-158737424 TTGAAGGAAGGAAGGGAGGGAGG + Intergenic
982878456 4:160677307-160677329 AAGGAGGAAGGAAGGGAAAGAGG + Intergenic
982903379 4:161036802-161036824 CTGGAGGAAGAGAGTGAAAGAGG - Intergenic
983167013 4:164490353-164490375 TTGTATGAAGGGAGTGAAACCGG - Intergenic
983202199 4:164873294-164873316 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
983231982 4:165138098-165138120 TTGTAGAAGGAGAGGGAAACAGG + Intronic
983286131 4:165741898-165741920 ATGAAGGAAGGAAGGGAAAAAGG - Intergenic
983655538 4:170079999-170080021 TGCAAGGAAGGGAGGGAAAGTGG + Intronic
983727962 4:170953726-170953748 TTGAAGGAAGGGAGGGAGGGAGG - Intergenic
983908500 4:173209717-173209739 TGGCAGGTAGGGTGGGAAAGAGG - Intronic
984161062 4:176252442-176252464 TGGAAGGAAGAAAGGGAAAGAGG - Intronic
984238422 4:177189415-177189437 TTGGAAGAAGGGAGGGAGGGAGG - Intergenic
984858918 4:184219775-184219797 AGGGAGGAAGGGAAGGAAAGGGG + Intronic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985414131 4:189719303-189719325 GGGAGGGAAGGGAGGGAAAGGGG + Intergenic
985429145 4:189861270-189861292 AGGCAGGAAGGGAGAGAAAGAGG + Intergenic
985450925 4:190061784-190061806 TTTCAGGAAGGAAGGGAAAAGGG + Intergenic
985730321 5:1543868-1543890 GTGCAGGAAGGGAGGGCAAAGGG - Intergenic
985824853 5:2184622-2184644 TTATAGGAATGGATGGAAAAGGG + Intergenic
986636016 5:9823458-9823480 AGGGAGGAAGGGAGGGAAAAGGG + Intergenic
986661307 5:10062685-10062707 TTGTTACAAGGGAGGGAGAGTGG - Intergenic
987182224 5:15379803-15379825 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
987330417 5:16852112-16852134 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
987398906 5:17454365-17454387 TTGTAGTAAGGGTGGGAATGGGG + Intergenic
987525822 5:19047675-19047697 TTTTAGGCAGAGAGGAAAAGGGG - Intergenic
987723835 5:21671737-21671759 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
987817902 5:22928095-22928117 TTGTAGGGAAGGAGGTCAAGAGG - Intergenic
987872594 5:23640281-23640303 TTGGAGGGAGGGAAGGAAGGAGG - Intergenic
987979534 5:25064022-25064044 TAGTAGGAATGGAGGGTCAGAGG - Intergenic
988246441 5:28688721-28688743 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
988251557 5:28764791-28764813 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
988394172 5:30675781-30675803 AAATGGGAAGGGAGGGAAAGTGG + Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
988850097 5:35172375-35172397 TTGGAGGAAGGGAAGGAGTGAGG + Intronic
989077203 5:37576136-37576158 TTTTAGGGAGGGAGGGAGGGGGG - Intronic
989105296 5:37857402-37857424 ATGTTGGAAGGAAGGGAAACAGG - Intergenic
989121121 5:38005413-38005435 TAGTAGAAAGGAAGAGAAAGAGG + Intergenic
989316288 5:40082701-40082723 TTATAAGAAGGGAAAGAAAGAGG - Intergenic
990159711 5:52924144-52924166 TGGTAGGAAGGAAGGGAGAATGG - Intronic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990237056 5:53779694-53779716 CTGTTGGAAGGGAGAGGAAGTGG + Intergenic
990413920 5:55567894-55567916 TAGGGGGAAGGGTGGGAAAGGGG - Intergenic
990515121 5:56523903-56523925 CTGTAAGAAGGCAGAGAAAGAGG - Intronic
990626131 5:57613339-57613361 TTGGAGGAAAGGATGGAAGGAGG + Intergenic
990979164 5:61586333-61586355 GTGAAGAAAGGGAGGGAATGAGG - Intergenic
991172298 5:63642588-63642610 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
991191330 5:63877877-63877899 TTCAGGGAAGAGAGGGAAAGAGG - Intergenic
991235006 5:64383967-64383989 TAGAAGGAAGGGAGGCAAGGAGG + Intergenic
991422895 5:66459475-66459497 TTGTATAAAGAGAGGCAAAGAGG - Intergenic
991518921 5:67472480-67472502 TGGAAGGAAGGGAGGGAAGGAGG - Intergenic
992014480 5:72561577-72561599 TTGCAGGGAAGCAGGGAAAGGGG - Intergenic
992186434 5:74249021-74249043 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
992395564 5:76366332-76366354 AGAGAGGAAGGGAGGGAAAGAGG - Intergenic
992440585 5:76794528-76794550 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992519999 5:77540720-77540742 ATGTAGGGAGGGAGGGAGGGAGG + Intronic
992566148 5:77997157-77997179 GGATAGGAAGGGAGGGAGAGTGG - Intergenic
992623013 5:78611709-78611731 TTTAAGCAAGGGAGTGAAAGTGG + Intronic
992804098 5:80320021-80320043 GGGGAGGAAGGGTGGGAAAGGGG - Exonic
992865891 5:80956862-80956884 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
992873172 5:81026068-81026090 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
992940662 5:81758133-81758155 TAGAAGGAAGAGAGGGAAGGAGG + Intergenic
992962326 5:81968530-81968552 TTGGGGGAAGGGAGGCAAAGAGG - Intergenic
992996292 5:82337184-82337206 AGGAAGGGAGGGAGGGAAAGAGG - Intronic
993179976 5:84540146-84540168 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
993375080 5:87141150-87141172 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
993476999 5:88378558-88378580 CTGGAGGAAGGGAAAGAAAGAGG + Intergenic
993536961 5:89098542-89098564 ATGAAGGGAGGGAGGGAGAGAGG - Intergenic
994050714 5:95359383-95359405 TTCTAGGAAGGGAGGGAGGGAGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994122479 5:96132175-96132197 CAGAAGGGAGGGAGGGAAAGAGG + Intergenic
994523938 5:100880104-100880126 AAGAAGAAAGGGAGGGAAAGAGG - Intronic
994671325 5:102765015-102765037 TTGAAGGAAGTGATGGAAATAGG - Intronic
994842288 5:104941102-104941124 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
994913693 5:105945659-105945681 TGGGAGGGAGGGAGGGAAAGAGG + Intergenic
994996068 5:107064446-107064468 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
995028687 5:107454762-107454784 ATATAGGCAGGGAGGGAATGAGG + Intronic
995876592 5:116796726-116796748 ATGTAGGAGCGGAGGGCAAGTGG - Intergenic
996217606 5:120888334-120888356 TTGTGGGAAGTGCTGGAAAGTGG + Intergenic
996410522 5:123153945-123153967 TTGAGGGAAGGGAGGGTAGGGGG + Intronic
996793516 5:127319048-127319070 ATGGAGGAAGGGAGGGAGGGAGG - Intronic
997349712 5:133221798-133221820 ATGAAGAAAGGAAGGGAAAGGGG - Intronic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
997842563 5:137255710-137255732 TTGAAGTTAGGAAGGGAAAGGGG + Intronic
997922267 5:137993185-137993207 TAGTAGGGAGGGAGGGGATGAGG + Intronic
998025943 5:138816510-138816532 TGGTGGGAATGCAGGGAAAGGGG - Intronic
998152842 5:139766896-139766918 AGGAAGGAAGGGAGGGAAAGAGG - Intergenic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
998537438 5:142947310-142947332 TTGGAGGGAGGGAGGGATGGTGG + Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998678889 5:144442516-144442538 TTGGAAGGAGGGAGGGAAGGAGG - Intronic
999185655 5:149706502-149706524 TGGGAGGAAGGGAGGGAGAGTGG - Intergenic
999275112 5:150325061-150325083 TGGAAGGAAGAGAGGGAAGGAGG + Intronic
999444748 5:151630449-151630471 TGGAAGGAAGAGAGGGAATGAGG + Intergenic
999597821 5:153224543-153224565 TTGTGGGTAGGGAGGCTAAGAGG - Intergenic
999776139 5:154814332-154814354 TTCTAAGGGGGGAGGGAAAGGGG + Exonic
1000037358 5:157459753-157459775 TGGAAGGAAGGGAGGAAAGGTGG + Intronic
1000089463 5:157917703-157917725 TTGTAGTAGGGGAGGGAGATTGG - Intergenic
1000092897 5:157945788-157945810 AGGCAGGAAGGGAGGGAAGGAGG - Intergenic
1000289774 5:159859543-159859565 TTTTAGGGAGGGATGGATAGGGG + Intergenic
1000354733 5:160383490-160383512 TTGTTGGTAGGGATGTAAAGTGG + Intergenic
1000833673 5:166131581-166131603 GTGTAGGGATGGAGGGAGAGTGG + Intergenic
1000984882 5:167855816-167855838 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1001003807 5:168031790-168031812 AAGGAGGAAGGGAGGGAGAGAGG + Intronic
1001203575 5:169741435-169741457 TTGTGGGGTGGGAGGGAGAGAGG + Intronic
1001235474 5:170025779-170025801 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1001280477 5:170382958-170382980 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1001335017 5:170789759-170789781 TTGTAGGAGGGGAAGGAGCGGGG - Intronic
1001647013 5:173289716-173289738 AAGGAGGAAGGGAGGGAAGGGGG - Intergenic
1001937423 5:175715277-175715299 TAGGTGGAAGGGAGGGACAGAGG + Intergenic
1001958501 5:175865024-175865046 TTGGATGAAGGGAGGCAATGAGG - Intronic
1002001040 5:176196388-176196410 TTGTAGGTAGGGAGGGGCTGAGG + Intergenic
1002061024 5:176626247-176626269 CTGCAGGATGGGAGGCAAAGTGG + Intronic
1002168125 5:177360593-177360615 TGGAAGGAAGGGAGGGAGGGAGG + Intronic
1002253295 5:177942584-177942606 TTGTAGGTAGGGAGGGGCTGAGG - Intergenic
1002726089 5:181297519-181297541 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1003009221 6:2410489-2410511 GTGGAGGAAGAGAGGGAAGGGGG - Intergenic
1003031521 6:2605294-2605316 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1003146134 6:3512104-3512126 CTCTAGGAATGGAGGCAAAGTGG - Intergenic
1003238391 6:4319024-4319046 TTGTAGGAAGAAAGGAAAAGGGG + Intergenic
1003318984 6:5035704-5035726 GGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1003318999 6:5035735-5035757 GGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1003425935 6:5998377-5998399 TTGGAGGATAGGAGGGAGAGAGG - Exonic
1003872214 6:10412452-10412474 GAGGAGGAAGGGAGGGAAAGAGG + Intronic
1003912106 6:10752275-10752297 GTGTTGGAAAGGAGGGAAACAGG - Intronic
1004121487 6:12826988-12827010 TTGCAACAAGTGAGGGAAAGTGG - Intronic
1004131259 6:12921824-12921846 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1004307498 6:14514260-14514282 TTGGAGAAGGGGAGGGAATGGGG + Intergenic
1004319569 6:14621906-14621928 TTTTAAGAAGGAAGAGAAAGAGG - Intergenic
1004329147 6:14705744-14705766 ATGTAGGAAGGGGAGGAAAAGGG - Intergenic
1004658359 6:17686791-17686813 GGGTAGGAAGGTAGGGAAATAGG + Intronic
1004751278 6:18565364-18565386 AGGGAGGAAGGGAGGGAATGGGG - Intergenic
1004990156 6:21127755-21127777 TAAAAGGAAGGGAGGGAGAGAGG + Intronic
1005264764 6:24100430-24100452 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
1005310675 6:24556152-24556174 GGGAGGGAAGGGAGGGAAAGAGG - Intronic
1005357265 6:24996548-24996570 TGGTGGGAGGGAAGGGAAAGGGG - Intronic
1005365345 6:25070486-25070508 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
1005700982 6:28399819-28399841 CTCTAGGAAGGGAGCGAAAGGGG + Intergenic
1005797979 6:29387818-29387840 GTGTAGGAGGGAATGGAAAGAGG - Intronic
1005939305 6:30548752-30548774 TAGGAGGAAGGGAGGGAAGGAGG + Intronic
1006451158 6:34106521-34106543 TGGTAGGAAGGGAGGCCAGGGGG - Intronic
1006479533 6:34280607-34280629 TTGTAGAAAGGGATAGAAAATGG - Exonic
1006716334 6:36123089-36123111 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1006754399 6:36402736-36402758 TTGTTGAAAGGGAGGGACATAGG + Intronic
1006888218 6:37400093-37400115 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1007183502 6:39947941-39947963 GTGTAGGGAGGGAGGGAGGGGGG + Intergenic
1007315675 6:40986729-40986751 TGGTAGGCAGGGAGGGACAGAGG + Intergenic
1007741064 6:44009687-44009709 AGGTAGGAAGGGAGGGAGGGCGG + Intergenic
1008441602 6:51538234-51538256 TAGTAGGAAGGCAAGGAAACAGG - Intergenic
1008505070 6:52222028-52222050 ATGGAGGAAGGGAGGGAGGGAGG + Intergenic
1008541385 6:52549267-52549289 TGGAAGGAAGGGAGGGAGGGAGG - Intronic
1008546611 6:52589073-52589095 GTGTGGAAAGGAAGGGAAAGGGG - Intergenic
1008881586 6:56385712-56385734 TGGGAGGAAGGGAGGGGGAGTGG - Intronic
1009460906 6:63912111-63912133 TTGTAGAGAGGAAGGGAGAGAGG + Intronic
1009778252 6:68234387-68234409 ATGTAGCAAGGGAGGGGGAGAGG - Intergenic
1009828348 6:68897439-68897461 TTGAAGGAAGGGAGGGAGGGAGG + Intronic
1009828387 6:68897575-68897597 AAGAAGGAAGGGAGGGATAGGGG + Intronic
1010331635 6:74629971-74629993 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1010597180 6:77778152-77778174 GGGTGGGAAGGAAGGGAAAGGGG + Intronic
1010840456 6:80643653-80643675 TTGTAGGGCAGAAGGGAAAGAGG + Intergenic
1010922788 6:81704749-81704771 AGGAAGGGAGGGAGGGAAAGAGG + Intronic
1010960089 6:82135830-82135852 TGGTAGGAAAGAAGGGACAGTGG + Intergenic
1011017783 6:82777703-82777725 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1011602301 6:89070879-89070901 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1011695734 6:89911187-89911209 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1011822798 6:91272655-91272677 AAGAAGGAAGGAAGGGAAAGAGG - Intergenic
1011963365 6:93120380-93120402 AGGCAGGAAGGGAGGGAGAGAGG - Intergenic
1012464357 6:99501120-99501142 ATGTAGTGAGGGAGGGAGAGTGG - Intronic
1012595714 6:101036227-101036249 GTAGAGGAAGGAAGGGAAAGAGG - Intergenic
1013105981 6:107027182-107027204 TAGTTGGTTGGGAGGGAAAGGGG + Intergenic
1013392144 6:109696729-109696751 GGGTAGGAAGGGTAGGAAAGAGG + Intronic
1013548937 6:111188270-111188292 AAGAAGGAAGGGAGGGAGAGAGG - Intronic
1013882447 6:114921498-114921520 TTGTGGGGAGGGAAGGATAGGGG - Intergenic
1013896466 6:115094444-115094466 TTCTAGGACTGTAGGGAAAGTGG - Intergenic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014039325 6:116806682-116806704 TTGAAGAAAGGAATGGAAAGAGG + Exonic
1014242442 6:119032628-119032650 GAGGAGGAAGGGAGGAAAAGAGG + Intronic
1014743455 6:125172028-125172050 TGGGAGGGAGGGAGGGAAGGAGG - Intronic
1014835058 6:126151715-126151737 TGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1015085427 6:129284763-129284785 TTAGAGGGAGGGAGGGAGAGAGG - Intronic
1015158605 6:130126096-130126118 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1015163944 6:130182549-130182571 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1015263769 6:131268050-131268072 TAGAAGGAAGGGAGGGATGGAGG + Intronic
1015303464 6:131680112-131680134 TTGGAGGAAGCAGGGGAAAGTGG + Intronic
1015367518 6:132413787-132413809 TTGGAGGAAGAGAGGGAGAGAGG - Intergenic
1015891953 6:137978351-137978373 GACTAGGAAGGGAGGGAACGTGG + Intergenic
1015893969 6:137998566-137998588 ATGAAGGAAGGGAGGGAAAGAGG + Intergenic
1016244842 6:141969196-141969218 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1016317735 6:142808618-142808640 AAGTAGGGAGGGAGGGATAGAGG + Intronic
1016361946 6:143276717-143276739 TACTAGGAAGGGAGGGAGGGAGG + Intronic
1016534224 6:145092672-145092694 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1016534232 6:145092692-145092714 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1016991779 6:149935173-149935195 TGGAAGGAAGGTAGGGAAGGAGG - Intergenic
1017094821 6:150795496-150795518 ATGTAGACAGGGAGGGGAAGTGG - Intronic
1018274574 6:162117161-162117183 AAGTGGGAAGGGAGAGAAAGTGG + Intronic
1018442823 6:163828784-163828806 TTGGAGGAAGCAAGAGAAAGGGG - Intergenic
1018577108 6:165270542-165270564 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1018613989 6:165668766-165668788 AGGTAGGAAGGGAGGGAGGGAGG + Intronic
1018727900 6:166627519-166627541 TTGTAGGAAGGAGTAGAAAGAGG - Intronic
1018840362 6:167512196-167512218 TTGTTGGGAGGCAGGGAGAGTGG + Intergenic
1018991922 6:168680562-168680584 TGGAAGGAAGGGTGGGAATGGGG + Intergenic
1019273939 7:166180-166202 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1019273968 7:166263-166285 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1019730530 7:2627228-2627250 TAGGAGGGAGAGAGGGAAAGAGG + Intergenic
1019730587 7:2627413-2627435 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1019752247 7:2738615-2738637 TTCTAGGGAGGGAGGGAATGGGG + Intronic
1019784364 7:2965559-2965581 TTGTAGGAATGAAGGGGATGGGG - Intronic
1019874408 7:3796513-3796535 TTGTAGGCTGGGGGGGAGAGGGG - Intronic
1019901959 7:4027960-4027982 ATGGAGGAGGGGAGGGAGAGAGG + Intronic
1019908633 7:4083790-4083812 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1019937715 7:4267257-4267279 AGGAAGGAAGGGAGGGAAGGAGG - Exonic
1019968831 7:4523904-4523926 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1020129047 7:5549162-5549184 AAGGAGGAAGGGAGGGAGAGAGG + Intronic
1020164333 7:5796390-5796412 TGGAAGGAAGGGAGGGAGGGAGG - Intergenic
1020240375 7:6389946-6389968 AGGGAGGAAGGGAGGGAGAGAGG - Intronic
1020454603 7:8357493-8357515 TGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1020787561 7:12590331-12590353 GTGTAGGGATGGAGGGAGAGTGG + Intronic
1020813840 7:12879817-12879839 TTGTAGGAAGTGAGTGGAAGGGG + Intergenic
1020990077 7:15184783-15184805 TGGAAGGAAGGGAGGAAGAGAGG + Intergenic
1021042326 7:15877524-15877546 TTGTGGAAATAGAGGGAAAGTGG + Intergenic
1021329940 7:19324012-19324034 TAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1021602132 7:22374862-22374884 TTGGAGGAAGGCAGGAAAAATGG + Intergenic
1021725882 7:23547872-23547894 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1021770681 7:23997813-23997835 TTGTAGGTAGGGACAGAGAGAGG + Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1021894236 7:25219189-25219211 TAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1021896684 7:25243207-25243229 ATGAAGGAAGGGAGGGAGTGGGG - Intergenic
1021983515 7:26077560-26077582 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1022019232 7:26382367-26382389 GTGGAGGAGGGGAGGGAGAGTGG + Intergenic
1022201185 7:28119328-28119350 TTGTTGGAGGGGAGGGGCAGCGG - Intronic
1022332283 7:29391318-29391340 AGGTAGGAAGGGAAGGGAAGAGG + Intronic
1022804757 7:33810512-33810534 TGGTAGGAAGGGAGGGAATGTGG - Intergenic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023143579 7:37127363-37127385 TTCTTGGAATGGAGGGAAAGGGG - Intronic
1023259002 7:38340085-38340107 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1023329473 7:39099368-39099390 TTGGAGGGAGGGAGGGACAGCGG - Intronic
1023348951 7:39300333-39300355 GACCAGGAAGGGAGGGAAAGTGG + Intronic
1024070975 7:45785063-45785085 AAGGAGGAAGGGAGGGAGAGAGG - Intergenic
1024507028 7:50170415-50170437 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1024723758 7:52168988-52169010 TTGTATGAAATCAGGGAAAGGGG + Intergenic
1024799314 7:53057883-53057905 AGGGAGGAAGGGAGGGAGAGTGG - Intergenic
1025135297 7:56406689-56406711 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1025837899 7:65112896-65112918 GAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1025879370 7:65520187-65520209 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025885169 7:65583088-65583110 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1026181703 7:68046975-68046997 GTGCAGGAAGGGAGGCAAAAAGG - Intergenic
1026403774 7:70043536-70043558 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1026420612 7:70233220-70233242 TGGTAGGGAGGGTAGGAAAGTGG - Intronic
1026501701 7:70948262-70948284 ATGGAGGAAGGGATGGAAAGAGG - Intergenic
1026566737 7:71495776-71495798 TTGGAGACAGGAAGGGAAAGTGG - Intronic
1026571910 7:71538785-71538807 TTGAAGGGAGGAAGGGAAGGAGG + Intronic
1026613847 7:71884358-71884380 TTGATGGAAGGAAGGGAAACAGG - Intronic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1026833100 7:73622024-73622046 TGGAAGGAAGGGAGGGAGGGAGG - Intronic
1026833102 7:73622028-73622050 TTGTTGGAAGGAAGGGAGGGAGG - Intronic
1026927388 7:74204027-74204049 GGGAAGGAAGGGAGGGAATGAGG + Intronic
1026927460 7:74204231-74204253 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1026967412 7:74449008-74449030 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1027228250 7:76258272-76258294 CTGGAGGAAAGGAGGGGAAGCGG + Intronic
1027473021 7:78596173-78596195 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1027473033 7:78596206-78596228 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1027565647 7:79789967-79789989 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1027644839 7:80785012-80785034 ATGGAGGGAGGAAGGGAAAGAGG - Intronic
1028002788 7:85521708-85521730 TGGCAGAAAAGGAGGGAAAGTGG + Intergenic
1028191714 7:87860996-87861018 TTTTGGGAAGGGAGTGTAAGAGG + Intronic
1028215831 7:88132098-88132120 TGGAAGGAAGGGAGGGAGAATGG - Intronic
1028331864 7:89604844-89604866 TTGTAGGAAGGAGGGAGAAGAGG - Intergenic
1028453859 7:91017272-91017294 TTAGAGGAAGGAAGAGAAAGTGG + Intronic
1028519332 7:91712344-91712366 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1029141607 7:98414766-98414788 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1029417858 7:100454792-100454814 TTGTGGGAGAGGAAGGAAAGGGG - Intergenic
1029443197 7:100599609-100599631 GAGCAGGAAGGGAGGGATAGTGG + Intronic
1029474736 7:100776311-100776333 TTGAAGGAAGGGAGGGAGGGAGG + Intronic
1029628864 7:101737801-101737823 AGGGAGGAAGGAAGGGAAAGAGG + Intergenic
1029654328 7:101914391-101914413 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1029654336 7:101914411-101914433 ACGGAGGGAGGGAGGGAAAGAGG - Intronic
1029673103 7:102047493-102047515 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1029941400 7:104484357-104484379 GTGAAGGGAAGGAGGGAAAGGGG - Intronic
1030335738 7:108324031-108324053 ATGAAGTAAGGGATGGAAAGGGG + Intronic
1030646292 7:112065295-112065317 TTGAAGGAAGTGTGGAAAAGAGG - Intronic
1031468603 7:122143899-122143921 TGCGAGGAAGGGAGGGAGAGCGG - Intronic
1031743812 7:125468533-125468555 TTGCAGGGTGGGAGGGCAAGGGG - Intergenic
1032094347 7:128930080-128930102 CTGGAGGGAGGGAGGGAGAGTGG + Intergenic
1032172587 7:129597729-129597751 TAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1032231644 7:130079845-130079867 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1032231673 7:130079933-130079955 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1032421885 7:131787428-131787450 GTGTAGGTAGGAAGAGAAAGAGG - Intergenic
1032675827 7:134129123-134129145 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1033041994 7:137927376-137927398 GAGAAGGAAGGGAGGGAAGGAGG + Intronic
1033250118 7:139751532-139751554 TTGGAGGGAGGGAGGGAGGGAGG + Intronic
1033457058 7:141512095-141512117 TGGAGGGAAAGGAGGGAAAGCGG - Intergenic
1033584461 7:142763749-142763771 CTGTATGAAGAGAGAGAAAGAGG - Intronic
1033786768 7:144740951-144740973 TTGTAGGGTGGGAGGGAGAGAGG + Intronic
1033914764 7:146309859-146309881 AAGAAGGAAGGAAGGGAAAGAGG + Intronic
1033988861 7:147259962-147259984 TTGTGGGGAGGGAGGGATAGTGG - Intronic
1034015960 7:147586564-147586586 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1034310239 7:150081191-150081213 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1034442696 7:151094846-151094868 AGGGAGGAAGGGAGGGACAGAGG - Intronic
1034520720 7:151617265-151617287 AAGGAGGGAGGGAGGGAAAGAGG + Intronic
1034796602 7:154019450-154019472 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1034825865 7:154261998-154262020 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1035004319 7:155644137-155644159 TTGTAGGAAGTGAGGGCTCGCGG + Intronic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035299627 7:157888405-157888427 TTGTCAGAATGGAGCGAAAGCGG - Intronic
1035404639 7:158589029-158589051 TTGAAGGATGGGAGGGTGAGGGG - Intergenic
1035862011 8:3039301-3039323 AAGAAGGAAGGGAGGGAGAGAGG - Intronic
1035869124 8:3118026-3118048 TTGTAGGACCAGAGGGAAAAAGG - Intronic
1036123596 8:6043879-6043901 GGAGAGGAAGGGAGGGAAAGGGG - Intergenic
1036457205 8:8920225-8920247 ATGGAGGGAGGGAGGGAGAGAGG + Intergenic
1036457214 8:8920249-8920271 ATGGAGGGAGGGAGGGAGAGAGG + Intergenic
1036496624 8:9276053-9276075 AGGTAGGAAGTGAGGGAAAAAGG - Intergenic
1036950398 8:13133794-13133816 TTGCGGGAACGGAGGGGAAGCGG + Intronic
1037071531 8:14656326-14656348 GAGAAGGAAGGGAGGGATAGAGG - Intronic
1037071553 8:14656435-14656457 AAGAAGGAAGGGAGGGATAGAGG - Intronic
1037344436 8:17883930-17883952 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1037387178 8:18355546-18355568 TGGTAGAAAGGGAAGAAAAGGGG - Intergenic
1037540426 8:19865438-19865460 TGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1037564463 8:20105852-20105874 ATGTGGGGAGGGAGGGACAGTGG + Intergenic
1037806863 8:22062797-22062819 TGGGAGGGAGGGAGGGATAGAGG - Intronic
1037909921 8:22738248-22738270 TTCAAGGGATGGAGGGAAAGAGG - Intronic
1038129226 8:24710686-24710708 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1038414142 8:27380885-27380907 TGTTAGGAAGGTGGGGAAAGAGG + Intronic
1038503423 8:28063937-28063959 TTGCAGGAAGAGAGGGACTGGGG - Intronic
1038723905 8:30062035-30062057 TGGAGGGAAGGGAGGAAAAGAGG - Intergenic
1038750808 8:30294045-30294067 TAGGAGAAAGGGAGGGAGAGGGG + Intergenic
1039033074 8:33330761-33330783 TTTAAGGAAGGGAGGAAGAGGGG - Intergenic
1039166652 8:34688553-34688575 AGGGAGAAAGGGAGGGAAAGTGG - Intergenic
1039187701 8:34935237-34935259 AGGAAGGAAGGGAAGGAAAGAGG + Intergenic
1039218789 8:35304400-35304422 TTGTATGGGGGGAGGAAAAGAGG + Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039518950 8:38154564-38154586 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1039770781 8:40684751-40684773 TTAGAGGAAGAGAGGCAAAGAGG + Intronic
1040399563 8:47034626-47034648 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1040506366 8:48052474-48052496 TTGGGGGAAGGGAGGTAGAGAGG - Intronic
1040506956 8:48057640-48057662 TTCTGGGGAGGGAGGGAAAGGGG + Intronic
1040625582 8:49145915-49145937 TTGTAGGAAGGAAGAGATAGCGG - Intergenic
1040855585 8:51945321-51945343 TTATAGGAAGAAAGGGAATGAGG - Intergenic
1040896367 8:52373159-52373181 TTCTGGGAAAGGAGGGGAAGGGG + Intronic
1041321504 8:56618602-56618624 TAGGAGGAAGGAAGGAAAAGAGG - Intergenic
1041353624 8:56975973-56975995 TTGAAGGAAAACAGGGAAAGTGG - Intronic
1041928039 8:63257192-63257214 TGGAAGAAAGGGAGGGAAGGAGG - Intergenic
1041953594 8:63533072-63533094 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1042243648 8:66689613-66689635 TAGTAGGAAGCAAGGTAAAGAGG - Intronic
1042379841 8:68100827-68100849 TTGTAGGAATGGATTGCAAGGGG + Intronic
1042397676 8:68310977-68310999 AGGAAGGAAGGAAGGGAAAGAGG - Intronic
1042663033 8:71176813-71176835 AGGTAAGGAGGGAGGGAAAGAGG - Intergenic
1042925701 8:73966379-73966401 GTGTAGGAAGATAGGAAAAGAGG + Intronic
1042960493 8:74298738-74298760 TTGTAGGAAAGTTAGGAAAGTGG - Intronic
1043517380 8:81007198-81007220 TTGTGGGAAGTGCGGGAAAAAGG + Intronic
1043888565 8:85631071-85631093 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1043941862 8:86205161-86205183 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1044434470 8:92145947-92145969 TTTAGGGCAGGGAGGGAAAGTGG + Intergenic
1044832907 8:96267763-96267785 GTGTATGGAGGGAGGGATAGAGG - Intronic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1045087409 8:98701179-98701201 TGGAAGGAAGGGAGGGAGGGAGG + Intronic
1045409881 8:101906215-101906237 CTGTAAGAAGTGAGGGAAATGGG - Intronic
1045456003 8:102379615-102379637 TTGATGGAAAGGAGAGAAAGTGG - Intronic
1045511800 8:102817367-102817389 ATGAAGGAAGGGAGGGAGAGAGG + Intergenic
1045668897 8:104524707-104524729 TTGTAGGAAGGTAGGGTTAATGG + Intronic
1045831665 8:106469194-106469216 AAGAAGGGAGGGAGGGAAAGAGG - Intronic
1046072965 8:109281446-109281468 AGGGAGGAAGGGAGGGAGAGAGG - Intronic
1046200877 8:110926234-110926256 TGGAAGAGAGGGAGGGAAAGAGG + Intergenic
1046360849 8:113153173-113153195 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1046526173 8:115384710-115384732 ATGAAGAAAGGGAGAGAAAGAGG - Intergenic
1046588361 8:116175734-116175756 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1046847907 8:118939244-118939266 TTTGAGGAATGGAGGAAAAGGGG - Intronic
1046859114 8:119070513-119070535 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
1047056656 8:121172295-121172317 ATAGAGGAAGGGAGGGAAAAAGG + Intergenic
1047061820 8:121235684-121235706 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061826 8:121235700-121235722 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061832 8:121235716-121235738 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061845 8:121235748-121235770 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1047595993 8:126378407-126378429 TAGTAGGGAAGGAAGGAAAGAGG - Intergenic
1047741853 8:127812690-127812712 TGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1047927648 8:129697024-129697046 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1048151252 8:131896971-131896993 TTGGAGGAAGAGAGGGAGGGAGG - Intergenic
1048165601 8:132059045-132059067 TAGAAGGGAGGGAGGGAGAGAGG - Intronic
1048246027 8:132800931-132800953 CTGTAGGTAGGGAGAAAAAGAGG - Intronic
1048363203 8:133715504-133715526 ATGGAGGGAGGGAGGGAGAGGGG - Intergenic
1048513271 8:135081159-135081181 ATGAGGGAAAGGAGGGAAAGGGG + Intergenic
1048522155 8:135166423-135166445 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1048696280 8:137031685-137031707 TGGGAGGGAGGGAGAGAAAGGGG - Intergenic
1048849581 8:138631698-138631720 CTGTAGGATGGGAGGGTATGAGG - Intronic
1049349031 8:142154265-142154287 ATAAAGGAAGGGAGGGAAAGAGG - Intergenic
1049470825 8:142774353-142774375 TTCTGGGCAGGGAGGGAAAGGGG - Intronic
1049937570 9:514179-514201 AGGGAGGAAGGGAGGGAGAGAGG - Intronic
1050218017 9:3350458-3350480 TTGTTGGGAGGGATGGAAAATGG + Intronic
1050266057 9:3891047-3891069 TTTGAGGAAGGAAGGAAAAGTGG - Intronic
1050280310 9:4043500-4043522 CTGTAGGAAGGGCTGGGAAGGGG + Intronic
1050396898 9:5207887-5207909 CTGTATAAAGGCAGGGAAAGTGG - Intergenic
1050589895 9:7150029-7150051 CTGTAGAAAGGGAGAGGAAGGGG + Intergenic
1050598052 9:7223795-7223817 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1050612770 9:7370505-7370527 TTGTTGGAAGGGAGGCTATGGGG + Intergenic
1050794763 9:9524270-9524292 AGGGAGGAAGGAAGGGAAAGAGG - Intronic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1050996408 9:12224454-12224476 TTGGAGGAAGGAAGGTGAAGTGG + Intergenic
1051216410 9:14802982-14803004 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1051245788 9:15109451-15109473 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1051352410 9:16210213-16210235 TTTTAAGAAGGAAGGGAGAGAGG + Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1051900376 9:22032336-22032358 GGGAAGGAAGGGAGGAAAAGGGG - Intronic
1052386260 9:27827139-27827161 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1052433973 9:28402582-28402604 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1052783348 9:32803529-32803551 TGGTATTAAGGGAGGAAAAGTGG - Intergenic
1052863470 9:33451018-33451040 TTATAGGGTGGGAGGAAAAGGGG - Intergenic
1052977785 9:34424431-34424453 TTTTAGGAAGTGTGGGCAAGGGG + Intronic
1053179924 9:35960135-35960157 CTGTATGAAGGGATGGGAAGAGG - Intergenic
1053182106 9:35981576-35981598 TGGTAGGAAGAGAGGGAAGGAGG - Intergenic
1053346802 9:37384211-37384233 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1053424465 9:38001997-38002019 TTAATGGAAGGGAGGGGAAGGGG + Intronic
1053466831 9:38314688-38314710 TTGGAGGGAGGGAAGGAAAATGG - Intergenic
1054868869 9:70030850-70030872 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1055786016 9:79869595-79869617 TAGGAGGGAGGGAGGGAGAGAGG + Intergenic
1056368225 9:85928014-85928036 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1056407350 9:86287434-86287456 TTGTAGGCAGGGAGGCTCAGGGG - Intergenic
1057006316 9:91563739-91563761 AGGAAGGAAGGAAGGGAAAGAGG + Intronic
1057261967 9:93589836-93589858 TTGTGTGGAGAGAGGGAAAGGGG - Intronic
1057292779 9:93818098-93818120 GTGAAGGGAAGGAGGGAAAGAGG + Intergenic
1057292791 9:93818131-93818153 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1057499394 9:95584696-95584718 TGGGAGGAAGGGAGAGAGAGAGG + Intergenic
1057875666 9:98752432-98752454 AGGAAGGAAGGAAGGGAAAGAGG - Intronic
1057959392 9:99439936-99439958 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1058297188 9:103324024-103324046 GGGAAGGAAGGGAGGGGAAGGGG - Intergenic
1058960477 9:109988621-109988643 TCGAAGGGAGGGAGGGAAGGAGG + Intronic
1059497458 9:114721370-114721392 ATGAAGGAAGGGAGGGATGGGGG - Intergenic
1059660485 9:116395280-116395302 AGGTTGGGAGGGAGGGAAAGAGG + Intronic
1059874203 9:118615798-118615820 ATGGAGGGAGGCAGGGAAAGTGG - Intergenic
1059929842 9:119249882-119249904 AGGAAGGAAGGGAGGGAGAGAGG + Intronic
1059965443 9:119609367-119609389 AAGAAGGAAGAGAGGGAAAGAGG + Intergenic
1059975814 9:119715762-119715784 AGGTGGGGAGGGAGGGAAAGGGG + Intergenic
1060198362 9:121637567-121637589 TTGGAGGAAGGGAGGGGAGAGGG + Intronic
1060554642 9:124501948-124501970 TTGAGGGTAGGGAGGCAAAGAGG + Intronic
1060834574 9:126745474-126745496 TGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1061054161 9:128213482-128213504 TTGATGGAAGGGAGGGAGGGAGG + Intronic
1061469321 9:130810710-130810732 CTGAAGGAAGGGAGGGTATGAGG + Intronic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062449180 9:136608364-136608386 GAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1062751223 9:138255165-138255187 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1203365132 Un_KI270442v1:249508-249530 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1203371850 Un_KI270442v1:314136-314158 CTTAAGGAAGGGAGGTAAAGGGG + Intergenic
1203638831 Un_KI270750v1:139068-139090 GGGAGGGAAGGGAGGGAAAGGGG - Intergenic
1185574936 X:1163762-1163784 AGGGAGGAAGGGAGGGAGAGAGG + Intergenic
1185610968 X:1393330-1393352 AGGGAGGAAGGGAAGGAAAGAGG - Intergenic
1185712330 X:2314237-2314259 GGGAAGGAAGGGAGGGAAGGAGG + Intronic
1185765681 X:2724024-2724046 AGGAAGGAAGGGAGGAAAAGTGG + Intronic
1185766764 X:2732096-2732118 CTGTAGGAAGGGAGGAACGGAGG - Intronic
1185766966 X:2733148-2733170 GTGGAGGAAGGGAGAGACAGAGG - Intronic
1185768828 X:2749213-2749235 AGGGAGGGAGGGAGGGAAAGGGG - Intergenic
1185878811 X:3722090-3722112 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1185882674 X:3755396-3755418 AAGAAGGAAGGGAGGGAAGGGGG - Intergenic
1185954805 X:4477970-4477992 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1186239937 X:7555187-7555209 TGGGAGGAAGGAAGGGAAGGAGG + Intergenic
1186469343 X:9809040-9809062 TTGGGGGAAGGGAGGGAAAGGGG - Intronic
1186838433 X:13460911-13460933 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1186838440 X:13460940-13460962 AAGAAGGAAGGGAGGGAGAGAGG + Intergenic
1187126792 X:16461903-16461925 AGGGAGGGAGGGAGGGAAAGGGG + Intergenic
1187132234 X:16514128-16514150 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1187247047 X:17562191-17562213 TGGTAGGAAGAGAGGAGAAGGGG + Intronic
1188015182 X:25100548-25100570 TAGAAAGAAGGGAGGGAAGGAGG - Intergenic
1188397127 X:29698584-29698606 TAGAAGGAAGGGAGGGAGGGAGG + Intronic
1188437296 X:30175707-30175729 ATGTAGGAAGGCAGGGAGACAGG + Intergenic
1188699193 X:33237188-33237210 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1188870082 X:35361694-35361716 TTGTTTCAAGGGAGGCAAAGGGG - Intergenic
1189159248 X:38793819-38793841 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1189167235 X:38872184-38872206 TTGTTGGAAGAGAGGGTAACGGG + Intergenic
1189364903 X:40380742-40380764 AAGGAGGAAGGGAGGGAGAGAGG + Intergenic
1189830343 X:44966507-44966529 TTTTTGGAAGGGAGGGCATGTGG + Intronic
1189907337 X:45774985-45775007 TTGCAGGAAGACAGGCAAAGCGG - Intergenic
1190107037 X:47568435-47568457 CTGTAGGCAGGGAGGGGGAGGGG + Intronic
1190141585 X:47850599-47850621 TTGCAGGGAGGGAGGGAAAGAGG + Intronic
1190220784 X:48511209-48511231 TGGGAGGAAGGGAGGGAGGGAGG - Intronic
1190305201 X:49077990-49078012 TGGGAGGAAGCGAGGAAAAGAGG - Intronic
1190726198 X:53192524-53192546 GGGTAGGAAGGAAGGAAAAGAGG + Exonic
1190751832 X:53368861-53368883 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1190953138 X:55165523-55165545 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1191035973 X:56026915-56026937 TTGTATGCCGGGAGGGACAGAGG + Intergenic
1191720262 X:64223172-64223194 TGGTGGGAAGGCAGGGAAAATGG + Intergenic
1191735972 X:64388071-64388093 TTCTAGGAAGGGAGGAAGAGAGG + Intronic
1191840899 X:65513087-65513109 GTTGAGGAAGGGAGGGAAGGAGG + Intronic
1192093161 X:68182408-68182430 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1192109517 X:68350443-68350465 AGGAAGGAAGGGAGGGAGAGAGG - Intronic
1192161738 X:68793417-68793439 ATAGAGGAAGGGAGGGAGAGAGG + Intergenic
1192207814 X:69107702-69107724 AAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1192239815 X:69320175-69320197 TTGAAGGAAGTGAGGGAATAGGG - Intergenic
1192310207 X:70005609-70005631 GTGTAGGTATTGAGGGAAAGTGG + Intronic
1192430341 X:71107469-71107491 AAAGAGGAAGGGAGGGAAAGAGG + Exonic
1192540092 X:71961417-71961439 AGGGAGGAAGGGAGGGAGAGAGG - Intergenic
1193304831 X:79936231-79936253 TTTGGGGAAGGGAGGGAAAAGGG - Intergenic
1193751306 X:85348437-85348459 GTGTTGGAAGGGTGGTAAAGTGG - Intronic
1193971856 X:88065122-88065144 TTGTAGGAAGGGAAAGAAGAGGG - Intergenic
1194869650 X:99113388-99113410 TAGAAGGAAGTGAGGGAAAAAGG - Intergenic
1195067478 X:101250619-101250641 TTGCAGGAAGGGTGGGAAGAAGG + Intronic
1195637934 X:107139178-107139200 TTGGTAGAAGGGAGGGAAGGTGG + Intronic
1195892729 X:109713041-109713063 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1195897912 X:109767118-109767140 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1195966611 X:110435017-110435039 CAGAAGGAAGGGAGGGACAGAGG + Intronic
1196398273 X:115288934-115288956 AAGAAGGAAGGGAGGGACAGAGG + Intergenic
1196423609 X:115547238-115547260 AGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1196424374 X:115555274-115555296 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1196650063 X:118159329-118159351 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1196746733 X:119077909-119077931 ATGGAGGGAGGAAGGGAAAGGGG - Intergenic
1196793611 X:119485545-119485567 TGGAAGGAAGGGAGGGAGGGAGG + Intergenic
1196990145 X:121319939-121319961 TTGATGAAAGGAAGGGAAAGAGG + Intergenic
1197134585 X:123046103-123046125 TTGTAACAAGGGATGGAAAATGG + Intergenic
1197213979 X:123851103-123851125 TGGGAGGAAGAGAGGGAAGGTGG - Intergenic
1197226716 X:123961705-123961727 CTCTAGGAAGGGAGGAAGAGAGG - Intronic
1197298203 X:124745582-124745604 TTCTTGGATGGGAGAGAAAGGGG + Intronic
1197627537 X:128819405-128819427 TTTTGGGAAGAGAAGGAAAGGGG - Intergenic
1198041529 X:132857829-132857851 TTGAAGGAAGGGAGGAAAGGTGG + Intronic
1198071070 X:133148994-133149016 TTGGAGGGTGGGAGGGAAGGAGG - Intergenic
1198257455 X:134936855-134936877 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1198388059 X:136147446-136147468 TGGGAGGCGGGGAGGGAAAGAGG - Exonic
1198421352 X:136473022-136473044 TGGCAAGAAGGGAGGGAGAGAGG + Intergenic
1198489159 X:137121569-137121591 TGTTAAGAAGGGAGAGAAAGTGG + Intergenic
1198526306 X:137504506-137504528 TTGAAGAAAGGGATGGAAAGGGG + Intergenic
1198616992 X:138469188-138469210 TCGGAGGAAGGGTGGGAAGGGGG + Intergenic
1198804619 X:140481519-140481541 GTGTAAGAAGGGAGGGAGGGAGG + Intergenic
1198840769 X:140854965-140854987 TTGAAGGAAGGAAGGAAAGGAGG - Intergenic
1199510337 X:148614581-148614603 GAGAAGGGAGGGAGGGAAAGAGG - Intronic
1199849398 X:151714730-151714752 AGGAAGGAAGGGAGAGAAAGTGG - Intergenic
1199983454 X:152933852-152933874 TTGAAGTTAGTGAGGGAAAGGGG - Intronic
1200411969 Y:2869749-2869771 ATGGAAGAAGGGAGGAAAAGCGG + Intronic
1200520518 Y:4206061-4206083 ATGTACGCAGGGAGGAAAAGAGG - Intergenic
1200782322 Y:7227918-7227940 AAGAAGGAAGGGAGGGAAGGGGG + Intergenic
1201146059 Y:11066373-11066395 AGGTAAGAAGGGAGGGAAGGAGG + Intergenic
1201146435 Y:11067547-11067569 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1201300252 Y:12498772-12498794 TAGGAGGAAGGGGGGGAAGGGGG - Intergenic
1201421707 Y:13806609-13806631 TGGAAGAAAGGGAGGGAAGGAGG - Intergenic
1201434947 Y:13947438-13947460 TTGTAGGAAGTGGGGTACAGTGG - Intergenic
1201438609 Y:13985520-13985542 GTGTAGGGAGGGAGGGAGGGAGG - Intergenic
1201445964 Y:14057188-14057210 GTGTAGGGAGGGAGGGAGGGAGG + Intergenic
1201451139 Y:14116181-14116203 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1201741263 Y:17326350-17326372 GGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1201765414 Y:17569849-17569871 ACGGAGGAAGGGAGGGAGAGAGG + Intergenic
1201836138 Y:18336140-18336162 ACGGAGGAAGGGAGGGAGAGAGG - Intergenic
1202022958 Y:20486530-20486552 TTGAAGGAAGTAAGGTAAAGAGG + Intergenic
1202107800 Y:21388330-21388352 TTGGAGGGAGGGAGGGAATAAGG + Intergenic
1202231787 Y:22666274-22666296 ATGGAGGAAGGAAGGGAGAGAGG - Intergenic
1202311371 Y:23529891-23529913 ATGGAGGAAGGAAGGGAGAGAGG + Intergenic
1202386942 Y:24335447-24335469 AGGAAGGAAGGGAGGGAGAGAGG - Intergenic
1202483844 Y:25334681-25334703 AGGAAGGAAGGGAGGGAGAGAGG + Intergenic
1202559431 Y:26140703-26140725 ATGGAGGAAGGAAGGGAGAGAGG - Intergenic