ID: 1098987903

View in Genome Browser
Species Human (GRCh38)
Location 12:77031939-77031961
Sequence ATGGAGAAGTTGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 579}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098987903 Original CRISPR ATGGAGAAGTTGAAGGTGGA TGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
900715657 1:4141839-4141861 ATGGTGGAGTGGAGGGTGGACGG + Intergenic
900767557 1:4515270-4515292 ATGGAGACATTGCAGGTAGAGGG - Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901218477 1:7568177-7568199 ATGGTGATGTTGATGATGGATGG - Intronic
901218504 1:7568394-7568416 ATGGTGATGTTGATGATGGATGG - Intronic
901218542 1:7568718-7568740 ATGGTGATGTTGATGTTGGATGG - Intronic
901218552 1:7568792-7568814 ATGGTGATGTTGATGATGGATGG - Intronic
901218563 1:7568901-7568923 ATGGTGATGTTGATGATGGATGG - Intronic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903737061 1:25536559-25536581 TTGGAGAAGTTGAAGGTTCCTGG + Intergenic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
905143124 1:35865051-35865073 ATGGAGATGTTGAAGTTACAGGG + Intergenic
905228240 1:36493849-36493871 ATGGATAAGTGGTGGGTGGACGG - Intergenic
905312785 1:37062026-37062048 ATGGACAAGCTGAAAGTTGATGG + Intergenic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
905790107 1:40785011-40785033 ACTGGGAAGTTGAGGGTGGAGGG - Intronic
905794659 1:40808765-40808787 AAGGAGAAGTTGAAGATGCGGGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906522181 1:46474166-46474188 ATGGAGGAGGTGAAGGTGATGGG + Intergenic
907503710 1:54902314-54902336 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
907703056 1:56808191-56808213 ATGAAGAAATTAAAGCTGGAGGG + Intronic
907968658 1:59358905-59358927 ATGAAGAAATTGAGGATGGAGGG + Intronic
908828562 1:68156966-68156988 ATTGAGAACTTGAGGGCGGAAGG + Intronic
908852261 1:68387528-68387550 AAGGAGAAATGGAGGGTGGAAGG - Intergenic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910491430 1:87776680-87776702 TAGGAGAAGATGCAGGTGGAAGG - Intergenic
911759935 1:101602520-101602542 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912866104 1:113258034-113258056 ATGGAGAACTTTATAGTGGATGG - Intergenic
913179843 1:116311028-116311050 ATTGAGAACTGGATGGTGGATGG - Intergenic
913369682 1:118084097-118084119 AAGGAGAAGTGGAGGGTGGCAGG + Intronic
913379318 1:118191408-118191430 AATGAGAAGTTGAAGACGGATGG - Intergenic
913692552 1:121293120-121293142 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
914145004 1:144986974-144986996 ATGGAGAAGTTGTAGAAAGAAGG - Intronic
915339631 1:155169546-155169568 ATGGAGAAGATGAAGCTATATGG + Exonic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915498051 1:156295024-156295046 ATGGAGTAGTGGAGGGTTGAGGG + Intronic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916390610 1:164326714-164326736 ATGTAAAAGTTTCAGGTGGATGG - Intergenic
916941372 1:169682155-169682177 AAGGAGGAGTTTAAGGTGAAGGG - Intronic
916943920 1:169704866-169704888 ATGAAGAAACTGAAGTTGGAGGG - Intronic
917222319 1:172745086-172745108 GTGTAGAAGTTGAAAGTGAATGG + Intergenic
918006824 1:180548991-180549013 CAGGAGGAGTTGAAAGTGGATGG - Intergenic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
919412527 1:197264130-197264152 ATGGAGACTTGGAAGGTTGAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
920010179 1:202861456-202861478 ATCCAGTAGTTGAAGTTGGAGGG + Intergenic
920479871 1:206311477-206311499 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
920555127 1:206899039-206899061 ATGGAGAAGGAGGAGGTGCAGGG + Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
921342165 1:214145026-214145048 ATGGAGATGATGGAGATGGATGG + Intergenic
921405205 1:214771566-214771588 ATGTAGAAGTTGCAGGAGAATGG - Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922048273 1:221967232-221967254 AAGGAGGAATGGAAGGTGGAAGG - Intergenic
922845609 1:228681784-228681806 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
923334431 1:232954941-232954963 CTGGAGAAGATGATGTTGGAAGG + Intronic
923472268 1:234302468-234302490 ATGGAGAACTTGAGCGTAGATGG + Intronic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924529467 1:244881143-244881165 ATTGACAAGTTGAGGGAGGAAGG + Intergenic
1062908152 10:1193053-1193075 GTGGAGGTGTTGAGGGTGGAAGG + Intronic
1063604092 10:7507909-7507931 AGGCAGAAGGTGCAGGTGGACGG + Intergenic
1063740014 10:8807258-8807280 TTGGAGAAGTTGATGGTGCTTGG - Intergenic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064200248 10:13278406-13278428 ATGGTGAAATTGAAGGTTAATGG - Intronic
1064469878 10:15625339-15625361 ATCAAACAGTTGAAGGTGGAAGG - Intronic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065618357 10:27551964-27551986 AGTGAGAAGTTGATGATGGAGGG + Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066437508 10:35407714-35407736 AAGGAGGAGTGGAGGGTGGAAGG + Intronic
1067656096 10:48192720-48192742 ATGGATAACTTCAACGTGGACGG - Exonic
1067991299 10:51215712-51215734 AGAAAGAAGTGGAAGGTGGAAGG - Intronic
1068150593 10:53125767-53125789 AAGGACAAGATGAAGGTGAATGG + Intergenic
1068942286 10:62691776-62691798 AGGGAGAAGTTAAAGGTGTAAGG + Intergenic
1069078508 10:64063818-64063840 CATGTGAAGTTGAAGGTGGAAGG + Intergenic
1070855662 10:79606473-79606495 ATTGATAACTTGAAGATGGAGGG - Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072837951 10:98736974-98736996 ATTGAGAAGATGAAGGTTGAAGG + Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1074922023 10:118024434-118024456 ATGGATACGTAGAAGGTGGCGGG - Intronic
1075111927 10:119595231-119595253 AGGGAATAGATGAAGGTGGAGGG - Intronic
1075191963 10:120317399-120317421 GTGGAAAAGTTGAGGGTGAAGGG - Intergenic
1075918705 10:126191590-126191612 ATGGAGAAGACTAAGGTGGGGGG + Intronic
1076007594 10:126960254-126960276 ATGGAGAAGATGCAGGTGTGAGG + Intronic
1076431255 10:130404188-130404210 GTGGGGAAGTCCAAGGTGGAGGG + Intergenic
1076713240 10:132350584-132350606 ACGGGGAAGATGAGGGTGGAAGG + Intronic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077280562 11:1743184-1743206 ATGGACAAATGGAAGATGGATGG + Intronic
1077280567 11:1743222-1743244 ATGGACAAATGGAAGATGGATGG + Intronic
1078039665 11:7848234-7848256 AGGGAGAGATTGAATGTGGATGG - Intergenic
1079129937 11:17741470-17741492 ATGGTGAACATGGAGGTGGAGGG - Intronic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1082276277 11:50225247-50225269 AGGTAGAATTTAAAGGTGGAAGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1083429660 11:62607636-62607658 ATGGATAAGTGGAAGGTGATGGG - Intronic
1083547470 11:63559559-63559581 TTGGAGAATTTAAAGCTGGAGGG - Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083841180 11:65305085-65305107 ATGGAGATGATGAAGTTGAAAGG - Intronic
1084049722 11:66591913-66591935 ATAAAGAAGATGAAGTTGGAGGG - Exonic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084545957 11:69815199-69815221 ATGGATAGGTGGATGGTGGATGG + Intronic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1085254847 11:75166626-75166648 ATGGATGAGTAGTAGGTGGATGG - Intronic
1086371992 11:86164196-86164218 ATCGGGAAGTTGAAGTGGGATGG + Intergenic
1086990181 11:93294318-93294340 ATGGAAAAGTTGAAAGTAGTTGG + Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088262170 11:107954586-107954608 ATGGAGAACTTGAAGGTCAGTGG - Intronic
1088612559 11:111591879-111591901 AATGAGAATTTCAAGGTGGAAGG - Intergenic
1088809938 11:113385449-113385471 TGGGAGAAGTTGTAAGTGGAGGG - Intergenic
1089472228 11:118730614-118730636 AAGGAGGAATTGAGGGTGGAAGG + Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1090249572 11:125241989-125242011 ATGGTGAAGGTGGAGGGGGATGG + Intronic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092739463 12:11614146-11614168 AAGGAGAAATTGAGGGTGGAAGG + Intergenic
1092924990 12:13264406-13264428 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1093071305 12:14709320-14709342 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1093081062 12:14811909-14811931 ATGGAGAAATTAAAAGTGAACGG + Intronic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1093824492 12:23666969-23666991 AAGGAGAAATTGAAGGTGGTGGG - Intronic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095966976 12:47874724-47874746 ATGAAGAGAATGAAGGTGGATGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096596337 12:52698175-52698197 ATGGATAAATTGAGTGTGGAGGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099480849 12:83164469-83164491 ATGGAGATGTACAAGGTGAATGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100588879 12:96005591-96005613 AGGTAGAAATTGAAGGTGGAGGG - Intronic
1102368982 12:112365515-112365537 ATTGAGCAGTTGAATGTGGCTGG - Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102678800 12:114676243-114676265 CTGGAAGAGTTGAAGGGGGATGG - Intronic
1103004350 12:117409356-117409378 ATGGAGGGGTGGAAGGTGGATGG + Intronic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1104092404 12:125527294-125527316 ATGGAAGAGTGGAGGGTGGATGG - Intronic
1104092426 12:125527361-125527383 ATGGAAGAGTGGAGGGTGGATGG - Intronic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1106356622 13:28989652-28989674 ATGGGGAGGATGAGGGTGGACGG + Intronic
1107588275 13:41875939-41875961 ATAGAGAATATGGAGGTGGAGGG - Intronic
1108678876 13:52762447-52762469 ATGGTGAAGTTGGGGGAGGAAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1110955158 13:81545094-81545116 ATGGATATGTTAAAGGTGGAAGG - Intergenic
1110986007 13:81969277-81969299 ATGGAGAAGTTCAAGGTCAAGGG + Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115381925 14:32749782-32749804 ATGGAGGATTTGAATCTGGAAGG + Intronic
1115501656 14:34055093-34055115 ATGGAGAAGTGGAAGGGGTGTGG + Intronic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1116525543 14:45899864-45899886 ATGGACAAAATGAAGGTGGGAGG + Intergenic
1116923716 14:50610541-50610563 ATGGAGAAGTTGACAGTGAAAGG + Intronic
1117095707 14:52295270-52295292 ATGCAGAAGTTGCAGCTGGGTGG - Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1117399833 14:55348786-55348808 ATTTAAAAGTTGAAGGTGAAAGG + Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1119205194 14:72788719-72788741 AGGGGGAGGTTGATGGTGGAAGG + Intronic
1119513368 14:75229040-75229062 ATGCAGAGGTGGAAGGTAGATGG + Intergenic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1120662660 14:87269238-87269260 ATAAAGAAATGGAAGGTGGATGG + Intergenic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1124067914 15:26363364-26363386 ATGGAGAGATTGGAGGTGGCGGG + Intergenic
1124187918 15:27546098-27546120 ATGGCGTGGTTGAAGGTGGTGGG - Intergenic
1127052080 15:55094962-55094984 ATGAAGAAGATGAAGAGGGAGGG - Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128799765 15:70489979-70490001 ATGGATAAGTGGAACTTGGATGG - Intergenic
1129048127 15:72755285-72755307 ATGGAAAAGTTGAAAGTGAATGG - Intronic
1130012604 15:80163323-80163345 ATAGACAAGTTGAAGCTGGCTGG - Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1133313679 16:4868499-4868521 ATGGTGTAGTTGATGGTGTATGG + Intronic
1133534910 16:6692604-6692626 ATGGAAAAGTGCATGGTGGAAGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133869752 16:9675938-9675960 AAGGAGAAATGGAGGGTGGAAGG + Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1134863568 16:17583988-17584010 ATGGAGAATTGGGAGATGGAAGG - Intergenic
1135548128 16:23379192-23379214 ATGGAGAGGTGGATGATGGAGGG - Intronic
1135609101 16:23849315-23849337 ATAGTGTAGGTGAAGGTGGAGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137992714 16:53175983-53176005 ATGGGGATATTGAAGCTGGAAGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139136673 16:64212938-64212960 AGGGGGGAGTTGATGGTGGATGG - Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139351740 16:66341145-66341167 ATAGGGAAGTTGGAGGTAGAGGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1140647025 16:77043175-77043197 ATGGAGAAGTTTATAATGGATGG + Intergenic
1141132703 16:81446126-81446148 ATTGAGAGGTTGGAAGTGGAGGG + Intronic
1141461992 16:84183251-84183273 CTGGAGAATTTCAAGCTGGAGGG - Exonic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143579746 17:7818583-7818605 ATGAGGAAGGTGAAGGTCGAAGG + Intronic
1143887534 17:10076198-10076220 AGGGAGAAGTGGGAGGGGGAGGG + Intronic
1144346328 17:14353267-14353289 ATGGGGAAGTTGAAGGACAAGGG + Intergenic
1144546144 17:16197751-16197773 CTGGAGCAGTTGCAGGTGTATGG - Intronic
1144781276 17:17809782-17809804 AAGGTGAAGGTGAAGCTGGACGG + Intronic
1145202216 17:20956575-20956597 ATGGAGAAGATAAAGCTGAAAGG - Intergenic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147744893 17:42688938-42688960 ATGGAGCTGCTCAAGGTGGATGG + Exonic
1148342492 17:46881652-46881674 ATTGAGCAGCTGGAGGTGGAGGG - Intronic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149602272 17:57900631-57900653 ATGGTGATGATGATGGTGGAAGG - Intronic
1150572831 17:66402745-66402767 AGGGAGAAGTTGAAGATTTAGGG + Intronic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150670219 17:67188877-67188899 ATGGAAAGTTTGAAGGTTGATGG - Intronic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152332140 17:79679453-79679475 ATGGAGGGGTTCAAGGTGGAGGG - Intergenic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152599316 17:81253636-81253658 ATGGTGATGTTGATGGTGGTAGG - Intronic
1153544013 18:6186999-6187021 ATGGAGACGGGGCAGGTGGAGGG + Intronic
1153883047 18:9437361-9437383 ATGCAGAAGTTGCAGCTGCATGG - Intergenic
1155173673 18:23285301-23285323 AAGGAGGAATGGAAGGTGGAAGG - Intronic
1155822119 18:30391101-30391123 ATGGGGAACTAGAAGGCGGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156060600 18:33070510-33070532 ATGGAAAGGGTGAAGGTGTAGGG + Intronic
1156646715 18:39171663-39171685 GTGAAGGAGTAGAAGGTGGAGGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1158114571 18:53980309-53980331 ATGTAGAAGGTGTAAGTGGATGG - Intergenic
1158506075 18:58046296-58046318 ATGGAGAAGTAGAGGATGCAAGG - Intronic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG + Exonic
1162185171 19:8898994-8899016 ATGGTAAAGTTGAGGGTGAACGG + Exonic
1162185596 19:8902180-8902202 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162185974 19:8905027-8905049 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162186700 19:8910460-8910482 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162187310 19:8915597-8915619 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162188151 19:8923016-8923038 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1163058416 19:14740137-14740159 ATGGGAATGTGGAAGGTGGATGG + Intronic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1164678931 19:30121247-30121269 ATGGAGAAATGGATGGGGGATGG - Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1165074099 19:33271220-33271242 ATGGAGACCATGAAGTTGGAGGG - Intergenic
1165411696 19:35666241-35666263 GTGGAGGAGTTGGAGGTGGAGGG - Intergenic
1165641495 19:37391774-37391796 ATGAGGAAGATGAAGGTGTAGGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167019260 19:46861550-46861572 ATGGAGGGGTGGAAGGGGGAAGG - Intergenic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168644176 19:58049449-58049471 GTGGAGAAGTTGTAGGCGGGGGG + Intronic
925044649 2:763649-763671 GGGGAGAAGGTGAAGATGGAGGG + Intergenic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
926557232 2:14373280-14373302 AGGGAGTACTTGAGGGTGGAGGG + Intergenic
926632843 2:15152885-15152907 GAGGAGAAGTTGAAAGTGAAGGG - Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
926938548 2:18112001-18112023 ATGGAGAAGATAAAGATGGGAGG + Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927478550 2:23432811-23432833 AAGAAGAAGTTGAAGTTGGCTGG + Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928504327 2:31934200-31934222 AAGGAGCAGTTTAAGGTGTAAGG - Intronic
928661668 2:33508131-33508153 ATTGAGAAATTGAGAGTGGAGGG + Intronic
929098213 2:38284158-38284180 ATGTAGAAAATGAAGTTGGAAGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929794171 2:45046330-45046352 AGGGAGAAGTTTCAGGAGGAGGG + Intergenic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933798917 2:85944280-85944302 AAAGAGAAATGGAAGGTGGAAGG - Intergenic
933873098 2:86589372-86589394 AGGGACCAATTGAAGGTGGAGGG - Intronic
933912741 2:86957719-86957741 ATTGTGAAGGTGAAGATGGATGG + Exonic
934010254 2:87812171-87812193 ATTGTGAAGGTGAAGATGGATGG - Exonic
935214440 2:100965101-100965123 ATGGGGCAGATGAAGTTGGAGGG - Intronic
935448456 2:103181583-103181605 ATGTAGAAATTGAAGGTGTCAGG + Intergenic
935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG + Intergenic
935773818 2:106452891-106452913 ATTGTGAAGGTGAAGATGGATGG - Exonic
935906245 2:107843022-107843044 ATTGTGAAGGTGAAGATGGATGG + Exonic
935992712 2:108735545-108735567 ATTGTGAAGGTGAAGATGGATGG + Exonic
936128028 2:109808187-109808209 ATTGTGAAGGTGAAGATGGATGG + Exonic
936216669 2:110563298-110563320 ATTGTGAAGGTGAAGATGGATGG - Exonic
936425808 2:112417879-112417901 ATTGTGAAGGTGAAGATGGATGG - Exonic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937627825 2:124063520-124063542 AAGGAGAAGTTTAAGGTATAAGG + Intronic
938173473 2:129103371-129103393 AAATAGAAGTTGAAGGTGGCAGG - Intergenic
938681548 2:133696761-133696783 ATTGAGAGGTTGAAGGGTGAGGG + Intergenic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
940216666 2:151310066-151310088 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
940458251 2:153929501-153929523 ATGGCCTACTTGAAGGTGGAGGG - Intronic
941179990 2:162247946-162247968 TAGGAGGAGTTGAAGATGGAAGG + Intergenic
941431652 2:165421400-165421422 ATGAAGAAGCTGAAGCTGCAAGG - Intergenic
941998148 2:171621057-171621079 ATGGGGAATTTGAAAGGGGATGG + Intergenic
944143259 2:196479690-196479712 CTGGAGAGGTTGCTGGTGGAGGG - Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946211466 2:218150539-218150561 AGGGAGAACTTGAAGGTGACAGG + Intergenic
946260189 2:218483281-218483303 ATGGAGCAGTAAAAGGTGGGGGG + Intronic
946611682 2:221465469-221465491 ATAGGGAAGTTGAAGGTGTTGGG + Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948409366 2:237747287-237747309 GAGGAGAAGTTGAAGGTACAAGG + Intronic
948458503 2:238118255-238118277 ATGGAGGAATGGATGGTGGAGGG + Intronic
948695701 2:239732133-239732155 AGGGTGAGGTTGTAGGTGGAGGG - Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1169888017 20:10423045-10423067 ATGGAGAAGTAAATGGTGAATGG - Intronic
1170155300 20:13263683-13263705 ATGGAGTGTTTGAATGTGGAAGG + Intronic
1170182024 20:13542159-13542181 ATGGAAAAGTTGAAAGTAAAAGG + Intronic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1172196233 20:33093503-33093525 ATGAATGAGTTGACGGTGGATGG - Intronic
1172196257 20:33093606-33093628 ATGGATGGGTTGATGGTGGATGG - Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173976600 20:47191490-47191512 ATGGATTAGTGGATGGTGGATGG + Intergenic
1175077581 20:56389208-56389230 ATGGAGAAGTGGAGGGTCCAGGG - Intronic
1175934815 20:62509774-62509796 ATGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175935071 20:62510474-62510496 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1175935098 20:62510550-62510572 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1175935172 20:62510745-62510767 ATGGAGAGGTGGAGGATGGAGGG - Intergenic
1176520195 21:7818475-7818497 AGGGAGGAGTGGAAGGCGGAAGG + Exonic
1177386164 21:20411944-20411966 ATAGCCAAGTTGCAGGTGGAAGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178654221 21:34448487-34448509 AGGGAGGAGTGGAAGGCGGAAGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180926796 22:19560774-19560796 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181134938 22:20758616-20758638 ATGGACAAATGCAAGGTGGACGG + Intronic
1181478611 22:23183334-23183356 ATGGAGGAGTTGAATGTGCTTGG + Intronic
1182028513 22:27138772-27138794 TTGCAGAGGTTCAAGGTGGAGGG + Intergenic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
949769554 3:7564558-7564580 CTGGAAAAGTTGAAGCTCGAGGG + Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950326435 3:12114658-12114680 ATGGTGAAGTTGAGAGTTGAAGG - Intronic
950362119 3:12456859-12456881 TGGGTGAAGCTGAAGGTGGACGG - Intergenic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
951521779 3:23617016-23617038 AGGGAGAGCTTGAAGGTGCAGGG + Intergenic
952845382 3:37683780-37683802 AGGGGGTAGTTGAAGGTGGGGGG - Intronic
952877455 3:37958494-37958516 ATAGTGATATTGAAGGTGGAAGG - Intronic
953285474 3:41602383-41602405 AAGGAGAATTGGAAGGGGGAAGG + Intronic
954001970 3:47565036-47565058 ATGAAGGAGTTGAGGGTGGGAGG - Intronic
954455688 3:50598567-50598589 ATGGTGAAGTGGGAGCTGGAGGG + Intergenic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956421408 3:69089897-69089919 ATGGAGATGTTGCAGGAGGGTGG + Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956576725 3:70760322-70760344 ATGGAGGTGATAAAGGTGGACGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958626232 3:96627571-96627593 ATGGAGAAGTTCAAGCCTGAAGG + Intergenic
958698919 3:97563259-97563281 TTGGAGAATTTGATGTTGGAGGG + Intronic
959080337 3:101794219-101794241 ATAGAGAAGCTGAAGGGGGGAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959485914 3:106927165-106927187 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
959941869 3:112088839-112088861 ATGATGGAGTTGCAGGTGGATGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960176365 3:114522391-114522413 ATGGGGAAATTGAATATGGAGGG + Intronic
960734756 3:120766573-120766595 AAGGAGAAGATGAAGGGGTAAGG - Intronic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
961394539 3:126578035-126578057 ATTGAGAGGTTGGATGTGGAGGG + Intronic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963297504 3:143561926-143561948 ATGCAGGAGTTAAAGGTGAAGGG - Intronic
963320892 3:143807900-143807922 ATGGAGAAGGTGCCGGTAGAGGG + Intronic
963425067 3:145114211-145114233 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
963456814 3:145555622-145555644 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
963833103 3:150029825-150029847 AAGGAGTAGTTGGAGGTGGGAGG + Intronic
964308877 3:155371071-155371093 ATCGGGAAGTTGGAGGTGGGCGG - Intergenic
964917595 3:161855082-161855104 CTGGAGAAGTTGAAGGTCTGTGG - Intergenic
965626463 3:170687799-170687821 AAGGAGGAATGGAAGGTGGAAGG + Intronic
965640194 3:170822435-170822457 AAGGAGGAATGGAAGGTGGAAGG + Intronic
965676269 3:171200264-171200286 AAGGTCAAGTTGAAGGTGGTTGG + Intronic
965679181 3:171232862-171232884 AGGGAGGAGTTGAAGGAGTAGGG - Intronic
966567470 3:181398893-181398915 ATGGAAAAATTGATGATGGATGG + Intergenic
966715663 3:183010999-183011021 AGTGAGAAGTTGATTGTGGAGGG + Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
967148225 3:186624843-186624865 AACGACAAGGTGAAGGTGGAGGG + Intergenic
967215319 3:187204732-187204754 ACAGAGAAGTTGAAGGTCCAGGG - Intergenic
967217033 3:187219561-187219583 ATGGAGATGGTCAAGGTTGAGGG + Intronic
967840303 3:193999902-193999924 GTTGAGAAGTTGATGGTGGGAGG + Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968330025 3:197860288-197860310 ATTTAGAAGTTGAAGGAGGTTGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969256963 4:6008758-6008780 AGGGAGCTGTTGAAGGTGCAGGG - Intergenic
969462822 4:7337806-7337828 AGGGGGAAGGTGCAGGTGGAAGG - Intronic
969654256 4:8487293-8487315 ATGGAGGAATGGAGGGTGGAAGG + Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970696949 4:18689383-18689405 ACGGAGAAATTGAAGGAAGAGGG - Intergenic
971278494 4:25220861-25220883 AAAGAAAAGTTGGAGGTGGATGG + Intronic
971296506 4:25398362-25398384 ACTGAGAAGGTGAAGTTGGAAGG + Intronic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
972322914 4:37989359-37989381 TGGGACAACTTGAAGGTGGAGGG - Intronic
972718797 4:41675434-41675456 GTGGGGAAGTTGACGGGGGATGG - Intronic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
974639279 4:64608237-64608259 ATGGAGAAATAGTAGGTGAAGGG + Intergenic
974903630 4:68031862-68031884 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
976231209 4:82845212-82845234 AGGGAGAGGCTGCAGGTGGATGG + Intronic
977063423 4:92284223-92284245 ATGGAGAAGTAGGGGGTGGTAGG - Intergenic
978381697 4:108135522-108135544 ATGGCGAGAGTGAAGGTGGAGGG + Intronic
978795069 4:112700749-112700771 ATGGAGATTTTGAAGGGTGAGGG + Intergenic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979146473 4:117253349-117253371 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
979234138 4:118380587-118380609 ACAGAGAAGTTTAAGGGGGAAGG - Intergenic
979556456 4:122052973-122052995 GTGGAGGAGGTGAAGGTGAATGG + Intergenic
980501906 4:133666903-133666925 TTGGAGGAGTCCAAGGTGGATGG - Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
981174138 4:141660921-141660943 ATAGAGATGATGAAGGTGTAGGG - Intronic
982025387 4:151248669-151248691 TTGGAGAAGTGGAAGGCGCATGG + Intronic
982066629 4:151660135-151660157 ATGGAGAATTTGATGGTGCTTGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982810813 4:159824024-159824046 ATGGAGATCTTGAAGGGTGAGGG - Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985057546 4:186048666-186048688 AAGGAGGAATTGAGGGTGGAAGG + Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985312441 4:188616991-188617013 ATGAAGAAGATTAAGATGGAAGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989437466 5:41431882-41431904 ATGGACAAGTTGCAGGAGAATGG - Intronic
989574159 5:42973606-42973628 CTGGAGCCATTGAAGGTGGATGG - Intergenic
989717238 5:44478676-44478698 AAGGAGCAGTTGAAGGAGTAAGG + Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990836949 5:60032350-60032372 ATAGAGAAGTAGAAGTTGTATGG - Intronic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
990989091 5:61667956-61667978 GTTGAGAAGTTGTGGGTGGATGG + Intronic
991012525 5:61898959-61898981 ATGGAGGAAATGAAGGTAGAGGG + Intergenic
991939847 5:71839914-71839936 GAGGAGAAGTTCAAGGAGGATGG + Intergenic
992201210 5:74385843-74385865 ATGGGGAAGTCCAAGGTTGAGGG - Intergenic
993581797 5:89671953-89671975 ATAAAGAAGTTTAAGTTGGAGGG + Intergenic
993962285 5:94314087-94314109 TCAGAGAAGTTGAAGGTGGTAGG - Intronic
994707302 5:103222502-103222524 ATGGTCAAGTTGTTGGTGGAGGG - Intergenic
995106824 5:108384338-108384360 AACAAGAAGTTGAAGTTGGATGG - Intergenic
995655716 5:114423909-114423931 ATGGAGAAAGGGAAGGTGCAGGG + Intronic
995727819 5:115201115-115201137 ATGGAGAACTTAAAAGTGGAAGG - Intergenic
996344969 5:122478060-122478082 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
996527902 5:124498288-124498310 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999105419 5:149066584-149066606 ATGGAGAAGTTAAAAGCTGAAGG + Intergenic
999229628 5:150054014-150054036 ATGGAGGAGTTGAAGTTTGTGGG + Exonic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999476812 5:151907808-151907830 ATGGAGAAGATGACCTTGGAAGG + Intronic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001171620 5:169424834-169424856 ATGCAGAAGCTGAAGTTGCAAGG - Intergenic
1001295605 5:170496763-170496785 GTGGTGAGGTTGAGGGTGGACGG - Intronic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1002864614 6:1110022-1110044 AAGGAGAAGTTACAGATGGAAGG + Intergenic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1003899744 6:10643341-10643363 ATGGAGAAGGGGAAGGTCAAGGG - Intergenic
1004210108 6:13631758-13631780 GTGTACCAGTTGAAGGTGGAGGG - Intronic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1005692924 6:28324298-28324320 ATGTAGAGGTTGCAAGTGGAAGG + Intergenic
1005801075 6:29425685-29425707 ATGTTGATGTTGAAGCTGGATGG + Exonic
1006302127 6:33199318-33199340 ATGGAGCTGTTGAAGGGGGTAGG + Exonic
1007291049 6:40787045-40787067 AAGGAGAATGTGGAGGTGGAGGG - Intergenic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1008124649 6:47654636-47654658 ATGGAGGAGTTGATGGAGGCTGG - Intergenic
1008294903 6:49763668-49763690 AAGGAGAAGTTGAAGGGGTAAGG - Intergenic
1008908734 6:56709846-56709868 ATGGGAATGTTGCAGGTGGAGGG + Intronic
1008938604 6:57020353-57020375 TTTGAGGAGTTCAAGGTGGAAGG - Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009730184 6:67592512-67592534 ATTGAGAAGTTCAAGTTGAAGGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010697707 6:78997518-78997540 GTGGACAAATTGAAGGTGTACGG - Exonic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011098689 6:83696555-83696577 ATGAAAAAGTTGAAGGTTGCTGG - Intronic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012014536 6:93834528-93834550 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1012498521 6:99862419-99862441 ATGGAGAAATTGAAGAGGGCTGG + Intergenic
1013822354 6:114170054-114170076 ATGGAGAAGGTTAAAGTAGAAGG + Intronic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015675793 6:135746955-135746977 ATGGAAAATATGAAGGTGGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1017366144 6:153641979-153642001 ATAGTGAAGTTGGAGGTGAAAGG - Intergenic
1017950838 6:159133317-159133339 CTGGAGAAAATGAAGGTGTAAGG - Intergenic
1018077443 6:160229717-160229739 AAGGAGGAATGGAAGGTGGAAGG - Intronic
1018084644 6:160291022-160291044 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1020468418 7:8507287-8507309 ATGAAGAATTTGAAGGTGAAGGG + Intronic
1020792217 7:12641248-12641270 GAGAAGAAGTTGCAGGTGGAGGG - Intronic
1020953892 7:14715401-14715423 ATGGAGCACTTGAAGTTAGAAGG + Intronic
1021053772 7:16021393-16021415 ATGGAAAAGTGAAAGGTAGAAGG + Intergenic
1021054129 7:16026140-16026162 TTGAAAAAGTTGAAGGTGTAAGG - Intergenic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1021823148 7:24518147-24518169 AGGTTGAAGTTTAAGGTGGATGG + Intergenic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022990497 7:35702584-35702606 CTGGAGAAGTTGTCCGTGGAAGG - Intergenic
1023132589 7:37017581-37017603 ATGAAGAAGTTGAAGTGGGGAGG - Intronic
1023694698 7:42832916-42832938 ATGGAGAAGGTGAATATGAAAGG + Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027692645 7:81367764-81367786 TTGGAGGAGTTGGAGGTGGGTGG - Intergenic
1028316932 7:89414314-89414336 ATGGTGAGGTGGAAGGTGGGAGG - Intergenic
1028703004 7:93804882-93804904 GAGGAGAAATTGAAGGTGGGTGG + Intronic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1033077055 7:138259386-138259408 AGGGAGTAGATGAAGGGGGAGGG + Intergenic
1033215122 7:139487739-139487761 AAGGTGAAGGTGAAGGTGAAGGG + Intergenic
1034827583 7:154280451-154280473 ATAAAGAAGTCGAAGATGGAAGG - Intronic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1034906929 7:154957607-154957629 TTTGAGAAGTTCAAGGTTGAGGG - Intronic
1035342485 7:158172835-158172857 ATGGTGAAGTTGATGATGGTGGG - Intronic
1035342696 7:158174326-158174348 ATGGTGAAGATGATGGTGGTGGG - Intronic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1040492776 8:47940447-47940469 ATGGATAAGTTGGCAGTGGAAGG - Intronic
1040876435 8:52157260-52157282 ATGGAGAATCTGAAGGTGAGAGG + Intronic
1041419220 8:57647733-57647755 CTGGAGAAATGGAAGATGGATGG - Intergenic
1041428658 8:57752618-57752640 TTAGAGAAGTTAAAGGTAGAGGG + Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1042380610 8:68109060-68109082 ATTGAGAAGATGAAGGTCAAAGG + Intronic
1042601858 8:70506633-70506655 ATGGAGGAGTTAAGGGTGGTTGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043277127 8:78412080-78412102 ATGGATATTTTGAAGGTGGTTGG + Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1044755180 8:95454162-95454184 ATGTAGGAGTTGGGGGTGGAAGG - Intergenic
1044928366 8:97228533-97228555 ATGGATAACTAGAAGTTGGAAGG - Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045211878 8:100107235-100107257 ATGGAGAGGTGGGAGGTGGGGGG + Intronic
1045558010 8:103233358-103233380 AGGGTGAGGTTGAAGCTGGAAGG + Intergenic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1047102531 8:121694111-121694133 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1047216916 8:122883325-122883347 ATGGAGGAGATGGAGGTGGGCGG + Intronic
1047547002 8:125827942-125827964 AAGGAGAAGTTGGTGGTGGTTGG + Intergenic
1048015218 8:130491101-130491123 AGTGGGAAGTTGAATGTGGAAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048448772 8:134513026-134513048 ATGGGGCAGCTGACGGTGGAAGG + Intronic
1048618489 8:136105789-136105811 ATGGAGAAATTGAGAGTTGAAGG + Intergenic
1049868970 8:144958745-144958767 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
1050479193 9:6072645-6072667 ATGGAGAAGTTGCAGAGAGATGG - Intergenic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050824406 9:9927375-9927397 ATGGTGAATTTGAATGTAGAGGG - Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1050993394 9:12181748-12181770 TGGCAGAAGTTGAAAGTGGAAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1051953549 9:22662985-22663007 AGGGAGGAATGGAAGGTGGAAGG + Intergenic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1055238306 9:74151601-74151623 CTAGAGAAGTTGGAGGAGGAGGG + Intergenic
1055291720 9:74788581-74788603 ATGCAGAAGATAAAGGTAGATGG + Intronic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057968784 9:99532610-99532632 ATGCTGAAGTTGTAGGTTGAGGG - Intergenic
1057981931 9:99671425-99671447 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
1059014076 9:110495135-110495157 ATGGAGAAGTTGAATATACAAGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059584959 9:115596120-115596142 ATGGAGAAGTTCAAGGCGCTTGG - Intergenic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1060279937 9:122209024-122209046 ATAGTGCAGATGAAGGTGGATGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061766158 9:132882707-132882729 AGGGAGATGTTGGAGATGGAAGG - Intronic
1061865695 9:133490862-133490884 AAGGAGGAGTTGGAGGAGGATGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1186204978 X:7191592-7191614 CTGGTGGAGTTGAAGGTTGAGGG + Intergenic
1186205011 X:7191714-7191736 CTGGTGGAGTTGAAGGTTGAGGG + Intergenic
1186809558 X:13174853-13174875 GCTGAGAAGTTCAAGGTGGAGGG + Intergenic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187437200 X:19283524-19283546 ATGGTGGAGTTCAAAGTGGAAGG - Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1192491469 X:71579740-71579762 TGGGAGCAGTTGAAGGTGGCTGG + Intronic
1193898675 X:87147924-87147946 ATGTTAAAGTTGATGGTGGAAGG - Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194351144 X:92825761-92825783 AAGGAGGAATGGAAGGTGGAAGG - Intergenic
1194904067 X:99551631-99551653 ATGCTGAAGTTTGAGGTGGATGG + Intergenic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1196316852 X:114237038-114237060 ATGGAAGATTTGAAGGTGGGTGG - Intergenic
1196584966 X:117418892-117418914 AAGGAGGAATGGAAGGTGGAAGG - Intergenic
1196773998 X:119322198-119322220 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1198599536 X:138268744-138268766 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1199271906 X:145893850-145893872 ATGGCCTACTTGAAGGTGGAGGG - Intergenic
1199377779 X:147133586-147133608 AGGGAGGAGTGGAGGGTGGAAGG + Intergenic
1199463619 X:148111501-148111523 AAGGAAATGTTGAAGGTGGTTGG - Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1201380492 Y:13371801-13371823 ATGGAGAAGTTGTAGGGGTATGG + Intronic