ID: 1098989164

View in Genome Browser
Species Human (GRCh38)
Location 12:77045931-77045953
Sequence TGCCAGGTTGACAACCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098989164 Original CRISPR TGCCAGGTTGACAACCCTGG AGG (reversed) Intronic
900376561 1:2357440-2357462 GGCCAGGAGGACACCCCTGGTGG - Exonic
900882155 1:5390059-5390081 GGACATGGTGACAACCCTGGTGG + Intergenic
901740649 1:11339605-11339627 TCCCAAGTCCACAACCCTGGTGG - Intergenic
906071268 1:43018325-43018347 CGCTAGGTTGAGAAACCTGGAGG + Intergenic
911042821 1:93605073-93605095 TGCCACGCTGAAAGCCCTGGCGG + Intronic
911642447 1:100303553-100303575 TGGCAGGTTGACCACAGTGGAGG + Intergenic
913253938 1:116937455-116937477 GGCCAGGGTGACAGCACTGGGGG + Intronic
916070308 1:161166144-161166166 AGCTAGGGTGACAACCCTAGAGG - Intergenic
917030579 1:170686070-170686092 TGCCGGATTGACAGCCTTGGAGG - Intronic
920650996 1:207837117-207837139 TGCCACGTTGTCAGGCCTGGTGG + Intergenic
922910833 1:229215804-229215826 TGCCAGATTGTCCACCATGGAGG - Intergenic
923187243 1:231586155-231586177 AGTCAGGTTGAGAACCCAGGGGG + Intronic
1062817124 10:508923-508945 TGCCAGGTGGCTGACCCTGGAGG - Intronic
1064253549 10:13725393-13725415 TCCCAGGGTGACAAGCTTGGAGG - Intronic
1069818418 10:71212935-71212957 GGCCAGGGAGACAGCCCTGGGGG + Exonic
1074905361 10:117857968-117857990 TGCTAGGATGACATCCTTGGGGG - Intergenic
1076652475 10:131999353-131999375 TGCCAGTGTGACAGCCCTCGGGG + Intergenic
1076808601 10:132873683-132873705 TGCCTGGTTGTCATCCCTGAGGG - Intronic
1079997619 11:27311642-27311664 TGCCAGATTAACAACCCAAGTGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1089288435 11:117422542-117422564 TGCCAGCTGGATTACCCTGGAGG - Intergenic
1089670898 11:120056382-120056404 TGGCACCTTGACAACCCTTGGGG + Intergenic
1096240563 12:49957742-49957764 TGCCAGGAGGACAGCTCTGGAGG - Exonic
1097318840 12:58203108-58203130 TGCCAGGTAGACAGAGCTGGTGG - Intergenic
1098401572 12:70081997-70082019 TGCCAGCATGACAACTCTAGAGG + Intergenic
1098989164 12:77045931-77045953 TGCCAGGTTGACAACCCTGGAGG - Intronic
1101871162 12:108566611-108566633 GGTCTGGTTGACAGCCCTGGGGG - Intronic
1102033965 12:109760488-109760510 TGCCAGTTTGAGACCACTGGTGG - Intronic
1103263198 12:119607216-119607238 TGCCAAGATTAAAACCCTGGTGG - Intronic
1107483363 13:40803516-40803538 TTCCAGTTTCACAACCCTGCTGG + Intronic
1110059256 13:71020873-71020895 TGGCAGGCTCACAACCCAGGAGG - Intergenic
1112369440 13:98782060-98782082 TGCCATGTGGACAACTCAGGAGG + Intergenic
1115517603 14:34201744-34201766 TGAAAGGTTGAAAACACTGGTGG - Intronic
1118977518 14:70690503-70690525 TGTCAGGTTGGCCACCCTGCAGG - Intergenic
1123391501 15:19878621-19878643 TGCCAGCTTGACATCCTTGATGG + Intergenic
1124094687 15:26638163-26638185 GACCAGGTTCAGAACCCTGGTGG - Intronic
1124375368 15:29126056-29126078 TGCCAGAGTGACAAGCCTGGTGG + Intronic
1125457361 15:39873762-39873784 TGACTGGTTGACAATCGTGGGGG - Intronic
1125462507 15:39920308-39920330 GGCCACGCTGACCACCCTGGAGG - Exonic
1126903215 15:53336212-53336234 TCCCAGGGTGACCACCCTGAAGG - Intergenic
1129676728 15:77635629-77635651 TGCCTGCTGGACCACCCTGGTGG + Intronic
1130242771 15:82212078-82212100 TGGCAGGTTGACATCCTAGGTGG - Intronic
1130457663 15:84129197-84129219 TGGCAGGTTGACATCCTAGGTGG + Intergenic
1133118613 16:3592634-3592656 TGGCAGGTTAACAGCTCTGGAGG - Intronic
1134140360 16:11713132-11713154 TGCCAGGTTGCCAGGCGTGGTGG + Intronic
1134825334 16:17279924-17279946 AGACAGGCTGACATCCCTGGAGG - Intronic
1145940123 17:28738925-28738947 TGCCAGGTGGGCAACCATTGGGG - Intronic
1146057037 17:29586696-29586718 TTCCACTTTGGCAACCCTGGGGG - Intronic
1147427595 17:40353404-40353426 TCCCAGGTTCCCCACCCTGGAGG - Intronic
1151290833 17:73148661-73148683 TGCCAGGATGCCAAGGCTGGTGG - Intergenic
1156005809 18:32439531-32439553 TAGCAGATTGACAACCCTGCAGG + Intronic
1166176341 19:41074196-41074218 TGCCATGTTGACTAGGCTGGTGG - Intergenic
929199697 2:39221781-39221803 GGCCAGATGGACACCCCTGGCGG - Intronic
929576811 2:43057276-43057298 TGCCAGGCTGACAGGGCTGGTGG + Intergenic
935701983 2:105820620-105820642 TGCCAAAATGACAACTCTGGTGG - Intronic
935810680 2:106794211-106794233 TGCCAGCTTGAGATCGCTGGTGG - Intergenic
936501780 2:113072471-113072493 TCCCAGGCTCACACCCCTGGTGG + Exonic
938140987 2:128794452-128794474 TGCCAGGTTTACTGCCCTGATGG + Intergenic
939143492 2:138384088-138384110 AGCCAGGTGGATAAACCTGGAGG + Intergenic
941366883 2:164621102-164621124 AGACAGGTAGGCAACCCTGGAGG - Exonic
944132032 2:196357298-196357320 CTTCAGTTTGACAACCCTGGTGG + Intronic
1170480522 20:16760731-16760753 AGCCAGGTAGACGACCATGGGGG + Intronic
1173416014 20:42856602-42856624 TGCCCAGAAGACAACCCTGGGGG - Intronic
1173541554 20:43855944-43855966 AGCCAGGATGAAAACCCAGGTGG - Intergenic
1174298156 20:49563274-49563296 TGGCAGACTGAAAACCCTGGAGG - Intronic
1174491273 20:50897965-50897987 TGGCATGTTGAGAACCCTAGGGG - Intronic
1177052493 21:16254412-16254434 TGTCAGGTTGACAGACCTGATGG + Intergenic
1180009511 21:45040350-45040372 TGCCCTGCTGTCAACCCTGGTGG - Intergenic
1180515383 22:16136796-16136818 TGCCAGCTTGACATCCTTGATGG + Intergenic
1184853591 22:47134844-47134866 TGCCAGGCAGAGGACCCTGGAGG - Intronic
949400686 3:3662533-3662555 TGCTGGGTTGACCACTCTGGAGG - Intergenic
950311944 3:11966559-11966581 TTCCAGTTTAGCAACCCTGGTGG + Intergenic
950627646 3:14259851-14259873 TTCCAGCTTGACAACTCTGTTGG + Intergenic
956424280 3:69117172-69117194 GGCCAGGGTGAGAACGCTGGAGG - Intronic
958702760 3:97615270-97615292 TGTCAGACTGAAAACCCTGGTGG - Intronic
963973798 3:151458633-151458655 TGCCTGGTCGCCACCCCTGGGGG - Exonic
967061924 3:185880242-185880264 TGCCAGGAAGACATCCATGGAGG + Intergenic
968651684 4:1762658-1762680 TGCCAGGTTTAGACCCCTGCAGG - Intergenic
969890495 4:10255529-10255551 GGTCAGGTTGACAACCTTGGAGG + Intergenic
970653014 4:18198884-18198906 TGCCTGGGTGACAACAGTGGTGG - Intergenic
971808987 4:31398910-31398932 TGCCAGGATGAAAAGCCAGGTGG + Intergenic
973850282 4:54955111-54955133 TGCCAGGTTGGCAACCCTGAAGG + Intergenic
980111235 4:128639366-128639388 TGGCAGGAAGGCAACCCTGGAGG - Intergenic
980864493 4:138538893-138538915 TCCCAAGTTGACACCCTTGGGGG - Intergenic
992002906 5:72452587-72452609 AGCCAGTTTGACAACAGTGGTGG + Intronic
993098895 5:83512176-83512198 TGCCAGGCTGGCAACAGTGGGGG + Exonic
997456074 5:134018497-134018519 TGGCAGATTGACAACCCAAGAGG - Intergenic
1000060502 5:157651572-157651594 TTCCAACTTGACCACCCTGGAGG + Exonic
1001567839 5:172712005-172712027 TGACAGGGTGAGAATCCTGGTGG - Intergenic
1002484547 5:179525064-179525086 TGCCAGTTGCACAGCCCTGGAGG - Intergenic
1004248314 6:14001684-14001706 TGGCCGCTTGACAACTCTGGTGG + Intergenic
1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG + Intronic
1007782490 6:44262647-44262669 TGCCAGGTGGACCAGCCTAGGGG + Exonic
1012611953 6:101228785-101228807 TGGTAGATTGCCAACCCTGGAGG + Intergenic
1014013963 6:116508294-116508316 TGCCAGGTAGACAAGACTAGGGG + Intronic
1014854196 6:126379472-126379494 GGCCAGGCTGACAGCCCTGGAGG - Intergenic
1015488661 6:133800434-133800456 TGCCAGCTGGAAAACACTGGTGG + Intergenic
1020910962 7:14130896-14130918 TTGCAGGTTTCCAACCCTGGAGG - Intergenic
1023146303 7:37153993-37154015 TGCCTGGGTAACACCCCTGGAGG - Intronic
1030087020 7:105824821-105824843 TACCAGGTTCACACCCATGGAGG - Intronic
1032515166 7:132501499-132501521 TCCCAGGATGCCCACCCTGGAGG - Intronic
1033890336 7:146005084-146005106 TGCCAGGTTGCTCACCCAGGTGG + Intergenic
1036195965 8:6715207-6715229 TGCCAGGTTGTTTAGCCTGGTGG + Intronic
1037946653 8:22993783-22993805 TGCCAGGCAGACAGCTCTGGAGG - Intronic
1038143568 8:24872518-24872540 TGCCAGGGTGAATACTCTGGAGG - Intergenic
1039186362 8:34921642-34921664 TGCCAGAGTGACATCCCTGCTGG - Intergenic
1039326805 8:36494219-36494241 TGCCAGGATGACATCACAGGCGG + Intergenic
1040578794 8:48677871-48677893 TGCCAGGCCTACAACCCTGTGGG - Intergenic
1041012439 8:53558421-53558443 TGTCAGAATGAAAACCCTGGTGG - Intergenic
1047982064 8:130193470-130193492 TGCCCAGTTTCCAACCCTGGAGG - Intronic
1052806004 9:33013934-33013956 TGCCAGATTTACAGCCCTAGGGG - Intronic
1055505351 9:76942499-76942521 TGCCAGATTGACTACTGTGGAGG - Intergenic
1056838355 9:89976471-89976493 TGCCAGGTTCAAAACCCAAGTGG - Intergenic
1059789535 9:117625404-117625426 TGCCAGATTGACAACTCTGGAGG - Intergenic
1060812268 9:126616450-126616472 TGCCAGGCAGAAAACCCAGGAGG - Intronic
1062158101 9:135065338-135065360 TGCCACGTGGACAGCCTTGGTGG - Intergenic
1188772863 X:34175694-34175716 TGCCATGTTGGCAAGGCTGGTGG - Intergenic
1189269034 X:39737382-39737404 TGCCAGGCAGACAAGGCTGGAGG - Intergenic
1197650128 X:129055199-129055221 AGCCAGGATGAAAACCCTAGTGG - Intergenic
1198830375 X:140744140-140744162 TGCCAGGTTTGCAGCCCTTGTGG - Intergenic
1199942907 X:152641956-152641978 GGCCAGGTTGACATCTCTGCAGG + Intronic
1200411777 Y:2868355-2868377 TGACAGGTTCCCGACCCTGGAGG + Intronic