ID: 1098990373

View in Genome Browser
Species Human (GRCh38)
Location 12:77059299-77059321
Sequence CAGGACAGACAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 420}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098990373_1098990378 9 Left 1098990373 12:77059299-77059321 CCTTGCTCCATCTGTCTGTCCTG 0: 1
1: 0
2: 3
3: 57
4: 420
Right 1098990378 12:77059331-77059353 CAGCATATACGGCTGTGGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 72
1098990373_1098990380 21 Left 1098990373 12:77059299-77059321 CCTTGCTCCATCTGTCTGTCCTG 0: 1
1: 0
2: 3
3: 57
4: 420
Right 1098990380 12:77059343-77059365 CTGTGGAAAGGGCACTGCAATGG 0: 1
1: 0
2: 0
3: 28
4: 276
1098990373_1098990379 10 Left 1098990373 12:77059299-77059321 CCTTGCTCCATCTGTCTGTCCTG 0: 1
1: 0
2: 3
3: 57
4: 420
Right 1098990379 12:77059332-77059354 AGCATATACGGCTGTGGAAAGGG 0: 1
1: 0
2: 2
3: 5
4: 109
1098990373_1098990376 -2 Left 1098990373 12:77059299-77059321 CCTTGCTCCATCTGTCTGTCCTG 0: 1
1: 0
2: 3
3: 57
4: 420
Right 1098990376 12:77059320-77059342 TGCTATGCTGACAGCATATACGG 0: 1
1: 0
2: 0
3: 3
4: 113
1098990373_1098990377 4 Left 1098990373 12:77059299-77059321 CCTTGCTCCATCTGTCTGTCCTG 0: 1
1: 0
2: 3
3: 57
4: 420
Right 1098990377 12:77059326-77059348 GCTGACAGCATATACGGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098990373 Original CRISPR CAGGACAGACAGATGGAGCA AGG (reversed) Intronic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
901422736 1:9162075-9162097 CAGGTCAGACAGGTGGAGCCAGG - Intergenic
903106408 1:21084363-21084385 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
903220123 1:21864847-21864869 CAGGACAGACCGATGTAGCCTGG + Exonic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
904913552 1:33953400-33953422 CAGGACAGACAGACTGTGCGAGG - Intronic
905011124 1:34747760-34747782 CAGGACAGACAAAAGGGGCCAGG - Intronic
905252434 1:36658361-36658383 ATGGACAGGCAGATGGACCAGGG - Intergenic
905272540 1:36796325-36796347 AAAGGCAGACAGATGGAGCCTGG + Exonic
905400744 1:37701304-37701326 CAGGAAAGACAGATCCATCACGG + Intronic
905693465 1:39958883-39958905 CAAGACAGAGAGAAGGACCAAGG - Intronic
906414219 1:45607431-45607453 CAGGACAGTGAAATGGAGAAGGG + Exonic
906674964 1:47686998-47687020 CAAGACAGACACATGGAGACAGG + Intergenic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907505888 1:54918074-54918096 GAGGAGAGAGAGATGGAGGAGGG - Intergenic
907647914 1:56262725-56262747 AATGAAAGACACATGGAGCAGGG + Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908466450 1:64401136-64401158 CCTGACTGACAGATAGAGCAAGG - Intergenic
908566567 1:65363068-65363090 CAGGACAGAGAAAGAGAGCAAGG + Intronic
908790212 1:67773590-67773612 AAGGAGAGAGACATGGAGCAAGG + Intronic
909344034 1:74564649-74564671 CAGGAGAGAGAGAGAGAGCAAGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
914810880 1:151027146-151027168 AAGGACAGCCAGATGGGTCAAGG - Intronic
915254542 1:154616365-154616387 GGGGACAGAGAGATGGGGCATGG - Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
917847118 1:179029049-179029071 CAGAACAGACTGTAGGAGCAAGG - Intronic
918359416 1:183740400-183740422 CATGGCTTACAGATGGAGCATGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
920342451 1:205284162-205284184 GAGGTCAGACACATGCAGCAGGG - Intergenic
920618947 1:207525055-207525077 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920620727 1:207543611-207543633 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920622509 1:207562168-207562190 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
921009119 1:211123633-211123655 GAAGACAGACAGATGGAGAAAGG + Intronic
921541594 1:216423075-216423097 TAGGACAGACAGATGGTGTTGGG - Intronic
921638980 1:217529034-217529056 TTGGACAGACAGATGATGCATGG + Intronic
921914857 1:220595957-220595979 CTTGACAGACATATGGAGCTGGG + Intronic
922065885 1:222142522-222142544 AAGAACAGACACATGGACCAAGG + Intergenic
922899335 1:229123925-229123947 AAGGACACACAGGTGGACCAAGG + Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
1064061539 10:12141769-12141791 CAGGACAGACCCCTGGGGCAAGG - Intronic
1064272591 10:13878909-13878931 CAGGACAGACAGATGAGGCAGGG + Intronic
1064651944 10:17518524-17518546 CAGGACAGACAGGTCAAGCCAGG - Intergenic
1065010735 10:21418571-21418593 GAGGACGGACAGAAGGAGCAAGG - Intergenic
1067059378 10:43070204-43070226 CTGGACAGACAGAGCAAGCAGGG + Intergenic
1069299714 10:66890892-66890914 GAGCACAGAGAGAAGGAGCAGGG + Intronic
1069576945 10:69537507-69537529 CAGGAGAGAGGGCTGGAGCAAGG - Intergenic
1070439964 10:76433478-76433500 TTGGACAGGCAGGTGGAGCACGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1071315957 10:84398241-84398263 GAAGACAGACAGAAGGAGAATGG - Intronic
1071590245 10:86865769-86865791 CAGGACATACAGTTTGACCAGGG - Intronic
1071674719 10:87644676-87644698 CAGGAAAGAGAGCTTGAGCAGGG - Intergenic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1072408034 10:95173039-95173061 GAGCACAGACAGATGGGGCCTGG - Intergenic
1072618412 10:97064465-97064487 TAGGATAGGGAGATGGAGCAGGG + Intronic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1073392870 10:103193420-103193442 CGGGACAGACAGACGCAGCGCGG - Intergenic
1073570493 10:104576962-104576984 CATGACAGGCAGATGGAGCCAGG - Intergenic
1073859512 10:107721572-107721594 CAGGAGAGAGAGAGAGAGCAGGG - Intergenic
1075556104 10:123433844-123433866 GAGGCCAGACTGATGGGGCAGGG + Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075769803 10:124923711-124923733 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076182406 10:128420520-128420542 CAGGAGAGAGAGAGGGCGCAGGG + Intergenic
1076316428 10:129545002-129545024 CAGGCCAGACAGACGAAGCAGGG - Intronic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076676707 10:132150805-132150827 GAGGACAGATAGATGGATTATGG - Intronic
1076723845 10:132404442-132404464 CAGGACATACGTAGGGAGCATGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1078870946 11:15344049-15344071 AAGGAGAGACAAATGAAGCAAGG + Intergenic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1080248152 11:30203031-30203053 CAAGACAGCCAGATGGAAGAGGG - Intergenic
1081589699 11:44412906-44412928 GAAGAGAGACAGATGGGGCAGGG + Intergenic
1082171974 11:49015735-49015757 CAGGACAGACCGCTGGAGCTTGG + Intergenic
1082958462 11:58896622-58896644 AAGGACACAAAGATGGAGTAGGG + Intronic
1084008743 11:66336280-66336302 CAGGGCAGCCAGGTGGGGCAGGG - Intronic
1084033419 11:66494011-66494033 CAGGACAGACACTTGGGGCAGGG + Intronic
1084558281 11:69888127-69888149 CTGGACAGCAAGAAGGAGCAAGG - Intergenic
1084717000 11:70880418-70880440 GAGGACTGAAAGATGGGGCAGGG + Intronic
1085299518 11:75450078-75450100 CAGGAGAGGCCGATGGAGCAGGG + Intronic
1086341044 11:85848795-85848817 CAGGACAGTAAGCTGGAGCCAGG - Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1088224444 11:107604038-107604060 CAGGACAGGAAAATGGAGCTTGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089648739 11:119897766-119897788 CAGGAAAGAAAGAGTGAGCAGGG - Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091110333 11:132960589-132960611 GAAGACAGACAGATGGAGAGGGG - Intronic
1092231760 12:6779701-6779723 CAAGACAGACAGACAGAGCAGGG - Intergenic
1092317872 12:7439070-7439092 CAGGACACAGGGCTGGAGCATGG - Intronic
1093140618 12:15506583-15506605 CAGGACAGAGAGAGAGAGCAGGG + Intronic
1093594981 12:20949148-20949170 TAGTACAGACCTATGGAGCAAGG - Intergenic
1093913358 12:24772509-24772531 AAGGACAGAAAGATGAAGAAAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094724150 12:33095364-33095386 CAGGAAAGAGAGAGAGAGCAAGG + Intergenic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095116729 12:38363073-38363095 CAGGACAGTCTGATGGAGACTGG - Intergenic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1095954625 12:47798975-47798997 AGGGACAGAGAGAGGGAGCAGGG + Intronic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098407711 12:70143189-70143211 CAGGAGAGACAGAGTGCGCAGGG - Intergenic
1098437329 12:70481766-70481788 CAGGACAGTGATATGGAGAAGGG + Intergenic
1098608917 12:72430616-72430638 AAGGACAGACATATAGATCAGGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1103342024 12:120225855-120225877 CAGGACAGGCAGCTGGGACAAGG - Intronic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1103899388 12:124295460-124295482 GAGGACAGCCTGAAGGAGCAGGG + Intronic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104677063 12:130718379-130718401 CAGGCCACACAGATGGAGTCAGG - Intergenic
1106404379 13:29461181-29461203 CAGGACAGAGAGAGAGAGAAGGG + Intronic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1114778394 14:25512491-25512513 CAGGAGAGAGAGAGTGAGCAAGG + Intergenic
1116805336 14:49489004-49489026 CAGGACTGACACCTGGAGCATGG + Intergenic
1120263656 14:82221059-82221081 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1120824508 14:88943276-88943298 CAGGGCAGACTCATGGAGAAGGG - Intergenic
1120866437 14:89299315-89299337 CAGGCAAGACAGCTTGAGCAGGG - Intronic
1121059302 14:90889862-90889884 CAGTACAGAAAGAAGGAGCAAGG - Intronic
1121113873 14:91330437-91330459 CAGGACAGACAGAGGCAGACTGG + Intronic
1122246171 14:100404953-100404975 CAGGAAAGACAGAACTAGCATGG - Intronic
1122355407 14:101120257-101120279 CAGAACAGACAGGAGGAGCATGG + Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1122897759 14:104768914-104768936 CAGGAAGGACAGATAGGGCAGGG - Intergenic
1123000353 14:105290711-105290733 CAAGACAGAGTGATGGAGGAGGG - Intronic
1123011371 14:105351061-105351083 CAGGACAGACAACGGGAGCCCGG - Intronic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125341838 15:38683124-38683146 CAGCACAGACAGATGAGGGATGG - Intergenic
1127942477 15:63713463-63713485 CAGGGCACACCGATGGATCACGG + Exonic
1130027939 15:80285991-80286013 GAGGACAGACAGAGGGGTCAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130830207 15:87591574-87591596 CATGACAGAAAGACAGAGCAAGG - Intergenic
1130999977 15:88932193-88932215 CAGGACAGTGAGAGGGATCATGG + Intergenic
1131065506 15:89432879-89432901 TAGGCCAGAGAGAGGGAGCAGGG - Intergenic
1131373475 15:91903982-91904004 CAGGACACAGTGATGGAGAAAGG + Intronic
1131959023 15:97768703-97768725 CATCATAGACAGATGGAACAAGG + Intergenic
1132536334 16:482936-482958 CAGGAAAGTCAGCTGGAACAGGG - Intronic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1134252599 16:12584979-12585001 CATGAGAGACTGAAGGAGCAGGG - Intergenic
1134262362 16:12661991-12662013 CAGGACAGTGTTATGGAGCATGG + Exonic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135858798 16:26036404-26036426 CAGGAAATACAGATTGGGCAGGG - Intronic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1137730681 16:50687387-50687409 CAGGACGGACACATGGAACTTGG + Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138490299 16:57372609-57372631 CAGGACAGTCAGATGGCAGAAGG - Exonic
1139458200 16:67100781-67100803 TAAGACAGACAGAAGCAGCATGG - Exonic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1141249981 16:82346908-82346930 AAGGACAGAGAGGAGGAGCAGGG + Intergenic
1141657716 16:85424974-85424996 CATGCCAGGCAGCTGGAGCAGGG + Intergenic
1142251794 16:88995342-88995364 CGGGACAGACAAATGAAGCGAGG - Intergenic
1142683980 17:1566682-1566704 GAGGACGGACAGAGGGAGCAAGG - Intergenic
1142744757 17:1950277-1950299 CAGGACACACTGACGGATCAGGG + Intronic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1144628225 17:16856424-16856446 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145070535 17:19801820-19801842 CAGCACAGACAGTTGGACGAAGG - Exonic
1145159817 17:20566991-20567013 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146055312 17:29577927-29577949 GGGGACAGACAAATGGAACAAGG + Intronic
1146505393 17:33400252-33400274 AAGGACACATAGGTGGAGCATGG - Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147218793 17:38916067-38916089 CAGGACAGACCCATTGAGGAGGG - Intronic
1147627616 17:41910110-41910132 GAGGACAGTCAGAGGGACCAGGG - Intronic
1147632756 17:41942691-41942713 CAGGGCAGAAAGATGTGGCAGGG + Intronic
1147961159 17:44168438-44168460 CAGGACAGGCAGCGGGAGAAGGG + Intergenic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148743972 17:49908249-49908271 CAGGACAGGGAGACAGAGCAGGG + Intergenic
1148872015 17:50663852-50663874 CAGGAAGGTCAGCTGGAGCAGGG + Exonic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149665957 17:58364885-58364907 GAGAACAGAGAGCTGGAGCAAGG - Intronic
1150107456 17:62472770-62472792 CAGGAGAGACAGGTGGACCTGGG + Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151756682 17:76079281-76079303 CAGGAAGGTGAGATGGAGCAGGG - Exonic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152938146 17:83152491-83152513 CAAGACAGGCAGATGGGGCCCGG + Intergenic
1153267892 18:3289012-3289034 CATGACAGACACATAGACCATGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153917726 18:9760636-9760658 CCCGACAGACAGAGGGAGAAGGG - Intronic
1156449414 18:37258641-37258663 CAGGACAGAGAGCTGGAGAGAGG + Intronic
1158106566 18:53891344-53891366 CAGGAAAGACAGAGGAAACAAGG + Intergenic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1161314092 19:3609849-3609871 CAGGACAGGCTGCTGGGGCAGGG - Intergenic
1162029910 19:7912842-7912864 AAGGACAGAGAGGTAGAGCAGGG - Exonic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1163188108 19:15653793-15653815 CAGGACAGAAAGGAGGAGAAGGG + Intronic
1163216783 19:15885056-15885078 CAGGACAGAAAGGAGGAGAAGGG - Intronic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1165061914 19:33209024-33209046 GAGGACAGACAGATGGACCTTGG + Intronic
1165294379 19:34914984-34915006 CAAGACAGAAAGATGAAGCTGGG + Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165435656 19:35793317-35793339 CAGGACACAGAGATGGAACCTGG - Intergenic
1165718351 19:38061671-38061693 GAGTACAGAGAGATGGAGCAGGG + Intronic
1166496281 19:43305382-43305404 CAGGACAGTCAGCTGGGCCAAGG - Intergenic
925711962 2:6750007-6750029 GAGGACGGACAGATGGAGCATGG - Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927992775 2:27459890-27459912 TAGGACAGGGAGATGAAGCATGG + Intronic
928096533 2:28408409-28408431 CAGGCCAGAGAGAAGGAGCTGGG - Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
928450033 2:31370505-31370527 CAGGTCAGCAAGCTGGAGCAGGG + Intronic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
929696054 2:44116372-44116394 TAGGAAAGACAGATGGATCTGGG + Intergenic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
932378383 2:71259053-71259075 CAGGACAGTAAAATAGAGCATGG + Intergenic
932800647 2:74739686-74739708 CAGGACAGACATTTGGGGAAGGG + Intergenic
933651272 2:84852296-84852318 CAGGACAGACCAATGCAGCAAGG + Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935214799 2:100967646-100967668 CAGGGCAGAAAGATGGACTACGG - Intronic
935659972 2:105458208-105458230 GAGGACAGAGAGAGGGAGCCGGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936264533 2:110992635-110992657 GAGGTAAGGCAGATGGAGCATGG + Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936736054 2:115445075-115445097 CAGGAAAGAGAGAGAGAGCAGGG - Intronic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
937866158 2:126753109-126753131 CAAGACTGGCAGGTGGAGCATGG + Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
940037470 2:149325894-149325916 GAGGAAAGAGAGATGGAGAATGG + Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946484131 2:220084692-220084714 CAGGACAGGCACATAGAGAAAGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
947527682 2:230889229-230889251 CAGGAGAGAGAGAGAGAGCACGG + Intergenic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
1168845672 20:942904-942926 AAGGACAGACAGCTGGAAAATGG - Intergenic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1170129470 20:13003063-13003085 CAGGAAAGAGAGAGAGAGCAGGG + Intergenic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1175146383 20:56899581-56899603 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1176893640 21:14349893-14349915 CGGGACAGACAGAAAGAACAGGG - Intergenic
1177803376 21:25849608-25849630 CAGGAGAGAGAGACGGTGCAGGG - Intergenic
1178412953 21:32380879-32380901 CAGGATAGAAAGATGTAGAATGG - Intronic
1178566210 21:33688727-33688749 GAGGAAAGACAGAGGGAGCTTGG + Intronic
1179012322 21:37565276-37565298 CAGGGCAGACAGATATGGCAGGG - Intergenic
1179055436 21:37927716-37927738 AAGGACAGACGGATGGAGGGAGG + Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179638640 21:42732035-42732057 GAAGAAAGACAGATGGAACACGG - Intronic
1180559243 22:16602033-16602055 CAGGAAAGACACATGGATCCCGG - Intergenic
1180713426 22:17855525-17855547 CAGGGCGGACGGATGGAGGAAGG + Intronic
1181379951 22:22494062-22494084 CATGACAGAAAGAGGAAGCAAGG - Exonic
1181609584 22:24003719-24003741 AAGCAGAGACAGATGGTGCAAGG + Intergenic
1182288375 22:29260854-29260876 CCGGGCAGACAGATGCAGCTGGG - Exonic
1182353678 22:29712631-29712653 GAGGACAGACAGATGGCAGAGGG - Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182739977 22:32560640-32560662 CAGGTCAGAAAGATGGGGAAGGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1184201844 22:42974924-42974946 CAAGGCAGCCAGCTGGAGCAAGG + Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1184863541 22:47190413-47190435 AGGGACAGACAGATGGGGCGGGG - Intergenic
1185082791 22:48718944-48718966 GGGGACAGACAGATGGTGGAGGG - Intronic
949140029 3:620731-620753 CATGGCAGACAGATGTAGAATGG - Intergenic
949406342 3:3718644-3718666 CAGCACAGCCAGCTGGAGAATGG + Intronic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950011712 3:9728849-9728871 GAGGTCAGAGAGATGGAGCTGGG - Intronic
950122761 3:10492715-10492737 CAGGAAAGGCAGGTGGATCAAGG + Intronic
951643817 3:24865583-24865605 CAGGACAGAGAGGTGGAAGAGGG - Intergenic
952111090 3:30124583-30124605 CAGGAGAGAGAGATAGAGCGAGG + Intergenic
952918205 3:38265721-38265743 GAGGAGTGACAGGTGGAGCAGGG + Intergenic
953170565 3:40503053-40503075 CAAGACACACACATGGAGCAGGG - Intergenic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
954794030 3:53152379-53152401 ATGGACTGACTGATGGAGCAAGG - Intergenic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955240876 3:57176977-57176999 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
956251493 3:67239003-67239025 CAGTACAGAAGGATGGAGAATGG - Intergenic
957357753 3:79114067-79114089 CAGGAAAGACAGCTTGTGCAGGG - Intronic
957979794 3:87494219-87494241 AAGGACGGACAGATGGAGGGAGG + Intergenic
958742113 3:98087222-98087244 CAGGACTTACAGATCGACCATGG + Exonic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
960197851 3:114792746-114792768 CAGGACAGAGAGATGGACGGGGG - Intronic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
967612842 3:191528244-191528266 TAGAACAGAAAGATGGAGGAAGG + Intergenic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969388702 4:6874613-6874635 CAGTACAGACAGGTGGTGAAAGG + Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969948062 4:10805227-10805249 CAGAACAGAAAGGTGGAGGAAGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971496707 4:27274447-27274469 CATGAAAGAGAGCTGGAGCAGGG + Intergenic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
975635823 4:76446922-76446944 CAGAGCAGACAGATTGAGCGTGG - Intronic
975768706 4:77697823-77697845 AATGACACACAGATAGAGCAGGG + Intergenic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977523191 4:98111595-98111617 CAGGCCAGGCAGATGTAGAAGGG - Intronic
978918563 4:114153518-114153540 CAGAACAGACATATGGATCTTGG + Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
982068635 4:151675706-151675728 CAAGACAAACAGATGTAACAAGG + Intronic
983895084 4:173072724-173072746 AAGGACAGACCAATAGAGCATGG - Intergenic
984594125 4:181648157-181648179 CAGAACAGACCAATGGAGCAGGG - Intergenic
984866984 4:184289206-184289228 CAGGCCAGACGGCTGGATCAAGG - Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985574899 5:669483-669505 CAGGACAGACAGAGGCCCCAAGG - Intronic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
985876929 5:2606994-2607016 CACACCAGGCAGATGGAGCAGGG - Intergenic
986420075 5:7571411-7571433 CAGAACAGAAAGGTGGAGGAAGG - Intronic
988032705 5:25784471-25784493 AAGGACAGAAAGATGGAACTGGG + Intergenic
988580012 5:32460632-32460654 CAGGACAGAGAGAAAGAGCAGGG + Intergenic
989162223 5:38402320-38402342 CAAGGCAGACAGATGGGGAATGG - Intronic
989724774 5:44575101-44575123 AATGACAGAGAGATGGAGGATGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990516060 5:56531845-56531867 AGTGACAGAAAGATGGAGCATGG - Intronic
992288596 5:75261619-75261641 GAGGACAGAAAGATGGAGAGAGG + Intergenic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
992948375 5:81832237-81832259 TAGAACAAAAAGATGGAGCAAGG - Intergenic
993251121 5:85524350-85524372 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
993962456 5:94316613-94316635 CAGGACAGCCAGATGGGGTGAGG - Intronic
994765953 5:103918930-103918952 CAGGACAGTCAGTTGGAGTGAGG + Intergenic
994993451 5:107028899-107028921 CAGGAGGGAGAGGTGGAGCAGGG - Intergenic
997348928 5:133216284-133216306 AAGAACAGGAAGATGGAGCAGGG - Intronic
997543823 5:134688595-134688617 GAGGATAGACATATAGAGCAAGG + Intronic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
999297409 5:150468412-150468434 CAGCAGTGGCAGATGGAGCAGGG - Intergenic
999302518 5:150500040-150500062 CGGGACAGACAGTTGGACAAGGG - Intronic
1001268878 5:170295945-170295967 CAGTACAGGGAGATGGACCACGG - Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007274839 6:40665665-40665687 GAGGACAGACAGGTTGTGCAAGG + Intergenic
1007609282 6:43138875-43138897 CAAGACAGCCAGCTGGAGGAGGG + Exonic
1007728915 6:43933843-43933865 CAGGACAGCCAGAGGGGGCTGGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1010571701 6:77481038-77481060 AAGGAAAGAGGGATGGAGCATGG + Intergenic
1011243964 6:85302143-85302165 CAGGACAAACTGAGTGAGCATGG + Intergenic
1011551141 6:88532032-88532054 TAGGAGAGAAACATGGAGCAGGG + Intergenic
1012677281 6:102132553-102132575 CAGGACAGAGACATGGAGAAAGG + Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1014561973 6:122901675-122901697 CAGCACTAAGAGATGGAGCAAGG - Intergenic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1015757124 6:136619051-136619073 CTGGACTGACATATGGAGCCTGG + Intronic
1016268680 6:142261956-142261978 CAGGAGTGAGAGAGGGAGCAAGG - Intergenic
1016451971 6:144192607-144192629 TAAGATAGACAGAAGGAGCAGGG - Intergenic
1017954722 6:159168919-159168941 AATGACAGCCAGACGGAGCAGGG + Intergenic
1018757966 6:166865908-166865930 AAGGAAAGACGGATGGAGAAGGG + Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021037871 7:15823396-15823418 CAGGACAGATAAAAAGAGCAAGG - Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1029175691 7:98662805-98662827 CAGGAAAGACAGCTGAAACAAGG + Intergenic
1029453892 7:100657459-100657481 GAAGAGAGACAGATGGAGAAAGG - Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030754805 7:113274177-113274199 CAGGAAAGAGAGAATGAGCAAGG + Intergenic
1032191177 7:129766880-129766902 CAGGTCAGGCAGCTGGAGCCCGG - Intergenic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1033366853 7:140678532-140678554 CAGGACAGCGAGAGGCAGCAGGG + Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034340908 7:150354423-150354445 CAGGAGAGACGGATGAAGCTGGG - Intergenic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1034557717 7:151860535-151860557 CAAGACAGAGAGAGAGAGCACGG + Intronic
1034618003 7:152435796-152435818 CAGGAAAGACACATGGATCCCGG + Exonic
1034834307 7:154337557-154337579 CAGAAATGACAGATGGTGCAAGG - Intronic
1035318814 7:158014890-158014912 GAGGAAAGACAGATGGAGATAGG - Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035665726 8:1378313-1378335 CAGGACAGACAGGTGAAGTCAGG - Intergenic
1035665770 8:1378603-1378625 CAGGACAGACAGGTGAGGCCAGG - Intergenic
1035665775 8:1378632-1378654 CAGGACGGACAGATGAGGCCAGG - Intergenic
1035936651 8:3848684-3848706 CAGATCACACAGATGGTGCAAGG - Intronic
1036595826 8:10211176-10211198 CAGGAAAGACAGATAGAGTGTGG + Intronic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1039212341 8:35232095-35232117 GAGGACTTACAGATTGAGCATGG - Intergenic
1041237669 8:55820831-55820853 AAGGACAGAGAGAGGGAGAACGG - Intronic
1041442280 8:57910153-57910175 AAGGACTGACAGATGAAGAATGG - Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1043517020 8:81004133-81004155 CAAAACACACAGATGGTGCACGG + Intronic
1043708935 8:83389700-83389722 AAGAACAGAGAGATGGAGAATGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1045696722 8:104817475-104817497 AAGGACAGGCAGCTGGAGCCAGG - Intronic
1047618027 8:126579339-126579361 CAAGACCGACAGATGGAGTTAGG + Intergenic
1048034670 8:130666161-130666183 CAGGACAGACACCTGGAGGCGGG - Intergenic
1048584396 8:135759376-135759398 CAGGACACCCAGATGTTGCAGGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048808590 8:138264034-138264056 CAGGAGATGAAGATGGAGCAGGG - Intronic
1048988731 8:139749133-139749155 AGGGAGGGACAGATGGAGCAGGG - Intronic
1051948314 9:22599248-22599270 CAGAACAGACAGATGTTGGATGG + Intergenic
1052520472 9:29541536-29541558 AAGGACAGAGAGATGGAGGCAGG - Intergenic
1053519597 9:38764348-38764370 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
1055662539 9:78519809-78519831 CAGGACAGTCAGGTGGGGCTGGG - Intergenic
1056621442 9:88217956-88217978 CAAGGCGGACAGATGGAGCCTGG + Intergenic
1057430216 9:94987320-94987342 AAGGACAGGCAGGTAGAGCATGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058924410 9:109648115-109648137 CAGGACAGAGAGAAAGAGCAGGG - Intronic
1059764936 9:117375146-117375168 AAGGACAGAGAGATGGACAAGGG + Intronic
1059775837 9:117474479-117474501 CAGGAGAGATAGATTGTGCAGGG + Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060375145 9:123110485-123110507 CAGGCCAGACAGATGGGTCCAGG + Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060816809 9:126639342-126639364 CAGGCCAGACAGATGATGGAGGG - Intronic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061386651 9:130294624-130294646 CAGCACAGAGGGAAGGAGCAAGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061769279 9:132905611-132905633 CTGGACAGACTGATACAGCAGGG - Exonic
1062052666 9:134455662-134455684 CAGGACAGAGGGATGCCGCAGGG + Intergenic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203562058 Un_KI270744v1:65511-65533 CAGGTCAGATAGGTGGAGGAGGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186673405 X:11790568-11790590 CAAGACAGACATTTCGAGCAGGG - Intergenic
1186898762 X:14031525-14031547 CAGGAAAGAAAGATGGAGAGGGG + Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187478056 X:19629241-19629263 CAGAACAGCCACATGGACCAAGG + Intronic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1188949294 X:36349175-36349197 CAGGCAAGACAGGTTGAGCATGG - Intronic
1189089327 X:38062977-38062999 CGGGAGAGTTAGATGGAGCAGGG - Intronic
1189877746 X:45454440-45454462 AAGGACAGATAGAAGAAGCAGGG + Intergenic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1193730829 X:85100847-85100869 AAGGACAGACATATAGACCAAGG + Intronic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194527396 X:94994224-94994246 AAGGACAGACATATGGACCAGGG - Intergenic
1195247077 X:103004558-103004580 CCCAGCAGACAGATGGAGCATGG + Intergenic
1196736361 X:118984163-118984185 CAGGTGAGACAGATGAAGCTGGG + Intronic
1197764985 X:130054429-130054451 AAGGAGAGAAGGATGGAGCAAGG + Intronic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1198276092 X:135097502-135097524 CACGACGGACAGCAGGAGCAGGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1199992888 X:152999012-152999034 GAGGAAAGTGAGATGGAGCAGGG + Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201569708 Y:15400636-15400658 CAAGACAGAAAGTTGGACCAGGG - Intergenic