ID: 1098990499

View in Genome Browser
Species Human (GRCh38)
Location 12:77060221-77060243
Sequence TTCACAGGACACTCTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098990499_1098990506 22 Left 1098990499 12:77060221-77060243 CCTCCATTAGAGTGTCCTGTGAA 0: 1
1: 0
2: 2
3: 10
4: 104
Right 1098990506 12:77060266-77060288 TAAATAGAGGTAATATACCTTGG 0: 1
1: 0
2: 1
3: 11
4: 194
1098990499_1098990505 9 Left 1098990499 12:77060221-77060243 CCTCCATTAGAGTGTCCTGTGAA 0: 1
1: 0
2: 2
3: 10
4: 104
Right 1098990505 12:77060253-77060275 TAGTTCTTATATATAAATAGAGG 0: 1
1: 0
2: 0
3: 33
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098990499 Original CRISPR TTCACAGGACACTCTAATGG AGG (reversed) Intronic
901734323 1:11302749-11302771 TTCAGAGGACTGACTAATGGTGG - Intergenic
903731489 1:25499353-25499375 TTCCCAGGGCACTTTACTGGAGG - Exonic
907053292 1:51344206-51344228 TTCATAGGACAGTCAGATGGAGG + Intronic
911659387 1:100483737-100483759 TTCTAAGGACAATCTAATTGAGG + Intronic
913169220 1:116217301-116217323 TTCACACCGCACTCTCATGGAGG - Intergenic
916775480 1:167958974-167958996 TCCACATGATACTATAATGGTGG - Intronic
921354659 1:214274822-214274844 TTAACAGGACACGGTAATTGGGG - Intergenic
924152964 1:241147375-241147397 ATCACAGCAAACTGTAATGGTGG - Intronic
1062952407 10:1514743-1514765 ATCCCAGGACACTCAAATGTGGG + Intronic
1063213592 10:3903951-3903973 TTGATAGGACACGCTAATGAAGG + Intergenic
1070039143 10:72757726-72757748 TTCAAAGAACATTCTCATGGGGG - Intronic
1071027808 10:81137118-81137140 TTCACAGGTCACTATTGTGGGGG - Intergenic
1075817198 10:125273696-125273718 TTCACAGGTCACACCACTGGGGG - Intergenic
1077009452 11:373697-373719 TGCACAGGACGCTCAAATAGTGG - Intronic
1077461890 11:2714921-2714943 TTACCTGGATACTCTAATGGGGG + Intronic
1077571125 11:3339341-3339363 TCCAGAGGACACTCAACTGGAGG + Intronic
1079867117 11:25750264-25750286 TTCATATCATACTCTAATGGTGG - Intergenic
1086327682 11:85720747-85720769 TGCACTGCACCCTCTAATGGGGG - Intronic
1086447775 11:86886414-86886436 TTCACAGGACAGTTTAAAGCTGG - Intronic
1086592376 11:88531173-88531195 TTCACAGGACACAGAGATGGAGG - Intronic
1088364764 11:109028992-109029014 TTCATATGACACTATAATGGTGG - Intergenic
1090309397 11:125721419-125721441 CTCCCAGGACTCTCTAATGCTGG - Intergenic
1092050806 12:5468731-5468753 GACACAGGACACTCTGCTGGGGG + Intronic
1092885371 12:12920284-12920306 TTTGCAGCTCACTCTAATGGAGG + Intergenic
1096499381 12:52055784-52055806 TCCCCAGGACACACTACTGGGGG - Intronic
1096679074 12:53242757-53242779 TGCAGAGGAGACTCCAATGGAGG - Intergenic
1097324777 12:58264126-58264148 GTCACAGGACAATTTGATGGTGG - Intergenic
1097336033 12:58384144-58384166 TTCACAGTAAACTCTGGTGGGGG + Intergenic
1097910508 12:64965081-64965103 TTAACAGGCCACTCTACTGCAGG + Intergenic
1098503370 12:71220554-71220576 ATCACAGGAATCTCTAATGGAGG - Intronic
1098807692 12:75040806-75040828 TTCACAGCACAACCTAATGTGGG + Exonic
1098990499 12:77060221-77060243 TTCACAGGACACTCTAATGGAGG - Intronic
1099884309 12:88508513-88508535 TTCCAAGGAGACTCTAATGATGG + Intronic
1100161135 12:91862160-91862182 TGCACAGAACACTCTGATTGAGG - Intergenic
1103164534 12:118758748-118758770 GTCAAAGGACAATCTAAGGGAGG - Intergenic
1103362550 12:120362399-120362421 TTCAGAGGACACCCTAATGTCGG + Intronic
1104391088 12:128391101-128391123 TTCTCAAGCCACTCTAATGGAGG + Intronic
1109690140 13:65876807-65876829 TACAAAGTAAACTCTAATGGTGG + Intergenic
1110574511 13:77040285-77040307 TTGACAGTACACTCTCATGAGGG - Intergenic
1112384505 13:98926061-98926083 TTCACAGGAATCTCTGGTGGTGG - Intronic
1116205998 14:41867296-41867318 TTAACATGACACTCTTATGTAGG - Intronic
1122385142 14:101339845-101339867 TTAAAAAGAAACTCTAATGGCGG + Intergenic
1122629696 14:103101922-103101944 TTCAAAGGTGACTCTAAGGGAGG + Intronic
1124159456 15:27255267-27255289 TTCACAGGACATTCTCGAGGAGG - Intronic
1125073976 15:35591112-35591134 TTCACAGCACACTCTAATGCAGG - Intergenic
1128698467 15:69786851-69786873 TTCTCAGGGCAGTCTACTGGGGG - Intergenic
1128816265 15:70610968-70610990 GGCACAGGACAGTCTAATGAGGG - Intergenic
1130234420 15:82121025-82121047 TCCACAGGTGACTCTAATGTGGG - Intergenic
1137860172 16:51839059-51839081 TTAACGGGACACTTTAATGGAGG + Intergenic
1140675170 16:77320961-77320983 TTCACTGGACACACTAGTGATGG - Intronic
1144200263 17:12934696-12934718 TTCTTAGGATACTATAATGGTGG + Intronic
1149152994 17:53592383-53592405 TCCATATGACACTATAATGGTGG - Intergenic
1150335247 17:64326228-64326250 TGCACAGGACACTCTGCTGCAGG + Intronic
1168590365 19:57629232-57629254 TTTAGATGACACTCTAATAGTGG - Intergenic
925385699 2:3460185-3460207 TTCACAGGACCCAGTAATTGAGG + Intronic
925701385 2:6641927-6641949 TTCACAGGGCACTCTATTACAGG + Intergenic
927375437 2:22407735-22407757 TTCCCAAGAGATTCTAATGGTGG + Intergenic
930295193 2:49545212-49545234 TTCATAGTACACTCTGATGGTGG + Intergenic
934783464 2:96987626-96987648 TTCCAAGGACACTCTAATCATGG + Intronic
944214663 2:197242700-197242722 TTAACAGGACACTCTAGTCTAGG + Intronic
1169430113 20:5528874-5528896 TTCACAGGTTACTCTAAGTGTGG - Intergenic
1169802255 20:9522332-9522354 GCCACAGGACGCTCTACTGGGGG - Intronic
1171127981 20:22621255-22621277 TTCAAAGGGCACTCTAAAAGGGG - Intergenic
1173393204 20:42653574-42653596 TTCACAGGCCAGTCTAGTTGTGG + Intronic
1175545887 20:59777482-59777504 TTCACAGCACATTCTGTTGGAGG - Intronic
1177019359 21:15834796-15834818 TTCACCAGCCACTATAATGGTGG - Intronic
950143694 3:10632945-10632967 ATCTGAGGACACTCAAATGGAGG + Intronic
954197196 3:49003816-49003838 TTCTCTGGCCACTCTAATAGGGG + Intronic
956429149 3:69166805-69166827 GTATCAGGACACTCTGATGGTGG + Intergenic
958489577 3:94754534-94754556 TCCACCTGAAACTCTAATGGAGG + Intergenic
960314089 3:116155176-116155198 TTCACTGGACTCTCTCATGAGGG + Intronic
964925127 3:161946566-161946588 TTGACAGGAAACTCTAGAGGCGG + Intergenic
966579134 3:181539826-181539848 TTCACAGGAAACTCTGCTTGAGG + Intergenic
968868735 4:3230231-3230253 TTCACAGGTCACTGTGATGTGGG + Intronic
970349118 4:15183384-15183406 TTCCCAGGCCACTCACATGGGGG + Intergenic
971129201 4:23787357-23787379 TTCACTGGACTTTCAAATGGAGG + Intronic
972055022 4:34790855-34790877 TTCACAGAAAAATCTAATGTTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
975594924 4:76040962-76040984 TTTCCAGGACACTCTAAGGCAGG - Intronic
978593467 4:110351700-110351722 TTGACAGGATCCACTAATGGGGG - Intergenic
978835492 4:113144846-113144868 TTTAGAGGAAACCCTAATGGAGG + Intronic
980801532 4:137757064-137757086 TTCTCATGACACTCTTTTGGGGG + Intergenic
982343141 4:154325708-154325730 TTCTCAGGACACTTGAATGGTGG - Intronic
983852078 4:172593514-172593536 TTCACCGACCACTCTATTGGTGG + Intronic
984122697 4:175765997-175766019 TTCAAAGGACACCCTAATGTTGG - Intronic
985095207 4:186406436-186406458 TTCTCAGCTCACTCTAAGGGTGG + Intergenic
990358227 5:54991675-54991697 TTCCCAGGACACTCTCATGCAGG - Intronic
990647716 5:57863363-57863385 TTCACAGGAAACTCTCATATTGG + Intergenic
994922402 5:106064868-106064890 TTCATATGATACTATAATGGTGG - Intergenic
1010149110 6:72709443-72709465 TTTACATAACACTCTGATGGCGG + Intronic
1014242196 6:119029741-119029763 TTCACTTGACATTCTAATGCAGG + Intronic
1014819212 6:125967762-125967784 TTCACAGGATACTATAAGGCAGG - Intronic
1014984337 6:127983885-127983907 TTCACAGGAAATGCAAATGGTGG + Intronic
1017157979 6:151339677-151339699 TTTGCATGACACTGTAATGGTGG - Intronic
1019842755 7:3464784-3464806 TTAACAGGACACACTAATGTCGG + Intronic
1021258504 7:18424428-18424450 GTCACTGGACACTATACTGGAGG + Intronic
1023055177 7:36285097-36285119 TCCCCAGGAGACTCTAATGAGGG - Intronic
1023524589 7:41086468-41086490 TTGACAGGACACTATAATGGTGG - Intergenic
1025708983 7:63890706-63890728 TTCTCTGGTCTCTCTAATGGAGG - Intergenic
1028697044 7:93726344-93726366 CTCACAGAACAGTCTAGTGGGGG - Intronic
1031694948 7:124839295-124839317 TTTATATGAGACTCTAATGGTGG + Intronic
1033321698 7:140345723-140345745 TTCACAGGACAATGCAAAGGTGG + Intronic
1035833665 8:2726084-2726106 TTAACAGGACAGAGTAATGGAGG + Intergenic
1036949505 8:13127825-13127847 TCCACAGGACACTCAAAGGTGGG + Intronic
1037718117 8:21417033-21417055 TAGACAGCACACTCTATTGGAGG + Intergenic
1040788650 8:51198192-51198214 TACATATGATACTCTAATGGTGG - Intergenic
1041853916 8:62426966-62426988 ATCACAGGACACTCCCATGCTGG + Intronic
1042873970 8:73423986-73424008 TTTATATGATACTCTAATGGTGG - Intronic
1043591636 8:81840975-81840997 TTCATACGAAACTCTACTGGTGG + Intronic
1048503882 8:135003392-135003414 TTCCCAGGACACTCCTATGAGGG - Intergenic
1055418438 9:76109688-76109710 TTAACAGTCCACTCTAATTGTGG + Intronic
1059642922 9:116235067-116235089 TCCACAGGAAACTCTAAGGATGG + Intronic
1059712583 9:116883178-116883200 TTCACAGGACATCCTACTGTGGG - Intronic
1194511697 X:94804461-94804483 TTCACTTTACACTCTAATGTGGG - Intergenic
1195934799 X:110114648-110114670 TTCAGAAGAAACTCTCATGGGGG - Intronic
1198750011 X:139930435-139930457 TTCACGTGGCACTCTTATGGTGG - Intronic
1200837015 Y:7741851-7741873 TTCAATGGAGACTCTAATGCTGG - Intergenic