ID: 1098990545

View in Genome Browser
Species Human (GRCh38)
Location 12:77060766-77060788
Sequence CTGGAAAGAAGGAGAGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098990545_1098990548 9 Left 1098990545 12:77060766-77060788 CCAACAACTCTCCTTCTTTCCAG 0: 1
1: 0
2: 3
3: 30
4: 366
Right 1098990548 12:77060798-77060820 TCTAGAAGCAATCCACACTGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1098990545_1098990549 10 Left 1098990545 12:77060766-77060788 CCAACAACTCTCCTTCTTTCCAG 0: 1
1: 0
2: 3
3: 30
4: 366
Right 1098990549 12:77060799-77060821 CTAGAAGCAATCCACACTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098990545 Original CRISPR CTGGAAAGAAGGAGAGTTGT TGG (reversed) Intronic
901514551 1:9736242-9736264 CTGGAGAAAGGGAGAGTTGGGGG + Intronic
901990397 1:13108210-13108232 CTGGATAGATGGAGGGGTGTGGG - Intergenic
902105068 1:14028245-14028267 CTGGCAGGAAGTAGAGTTGATGG + Intergenic
902643488 1:17781625-17781647 CTGGAAATAAGGATCTTTGTAGG - Intronic
904037722 1:27567787-27567809 CTGTGAAGAGGGAGAGATGTTGG - Intronic
904757014 1:32773561-32773583 CTGGAAGGCAGGAGGGTGGTTGG - Exonic
906156184 1:43615342-43615364 CTGGAAGGAAGGGCAGGTGTAGG - Intronic
906327291 1:44854983-44855005 CTGGTAAGGATGTGAGTTGTTGG + Intronic
906788556 1:48638120-48638142 CTGGAAAGGTGGTGAGTTTTAGG - Intronic
907271094 1:53291540-53291562 ATGGAAAGAAGGTGAGAGGTGGG - Intronic
907289876 1:53406968-53406990 CTGGAAGGATGGAGAGGAGTGGG + Intergenic
907706155 1:56834515-56834537 CTTGGAAGAAGGTGAGTTGCAGG + Intergenic
907778140 1:57538857-57538879 CTGGAGGGTTGGAGAGTTGTAGG - Intronic
907839509 1:58142760-58142782 CAGGAAAGATGGAGAGAGGTAGG - Intronic
908509598 1:64840927-64840949 ATGGAAAGAGGGAGAGATGGGGG - Intronic
909128103 1:71700820-71700842 CTTGAGATAAGGAGAGTTCTGGG + Intronic
909487208 1:76187606-76187628 CTGGAAGGCAGGGGAGATGTGGG + Intronic
909946838 1:81673329-81673351 CTGAAAAGAAGGAATTTTGTTGG - Intronic
909980745 1:82097900-82097922 TTGGAAAGAGGAAGGGTTGTTGG - Intergenic
910299353 1:85688299-85688321 CTGGAAAGTAGCAGAGCTGCTGG + Intronic
911958551 1:104269394-104269416 CTGCAAAGTAGGAGATTTCTGGG - Intergenic
912119971 1:106459004-106459026 CTGCACAGAAGCAGAGTTCTCGG + Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912796499 1:112696607-112696629 CTGGGAAGCAGAAGAGGTGTGGG - Intronic
916371931 1:164108001-164108023 CTGACAAGAAGGAGAGAAGTAGG - Intergenic
916989445 1:170226612-170226634 ATGGAAAGAAGGAGAGAGGAAGG - Intergenic
917354196 1:174108950-174108972 CTGGTAAGAAAGAGGATTGTGGG + Intergenic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
918442077 1:184577518-184577540 TTGGAATTAAAGAGAGTTGTGGG + Intronic
918486540 1:185034855-185034877 CTGGAAATTAGAAGAGTTATAGG - Intergenic
918669535 1:187198115-187198137 CTAGGCAGAAGGAGAGTAGTGGG - Intergenic
919836148 1:201574829-201574851 GTGGAAGGAAGGAGAGCTGCGGG + Intergenic
920583538 1:207135869-207135891 CAGCAAAGAAGGTGTGTTGTTGG - Intronic
920613178 1:207462398-207462420 CTGGAAAAAATCAGTGTTGTTGG + Intronic
921249003 1:213278909-213278931 TTGGAGAGAAGGAAAGTTCTCGG + Intergenic
921654566 1:217719550-217719572 AAGTAAAGAAGGAGAGTTGTTGG + Intronic
922493827 1:226040515-226040537 CTGGAAGGAAGGGGAGATGTGGG + Intergenic
922988939 1:229888553-229888575 CTGGACTGAAGGAGAGTTTATGG + Intergenic
1063368600 10:5506921-5506943 CAGGAAAGCAAGAGAGATGTGGG + Intergenic
1063997472 10:11633920-11633942 CTTGAAAAAAGAATAGTTGTTGG - Intergenic
1065003719 10:21360960-21360982 CAGGAAAGAAGCAGATTTCTTGG - Intergenic
1066127249 10:32353332-32353354 TTTGAAAGTAGGAGAGATGTGGG + Intronic
1067383760 10:45799461-45799483 CAGGAAAGCAGGAGGTTTGTGGG + Intergenic
1067463280 10:46474155-46474177 CTGGAGAGAAGAAGAGGTGGGGG - Intergenic
1067623914 10:47910483-47910505 CTGGAGAGAAGAAGAGGTGGGGG + Intergenic
1067732454 10:48821791-48821813 CTGGAATGCAGGAGAGTAGCAGG + Intronic
1067880423 10:50039331-50039353 CAGGAAAGCAGGAGGTTTGTGGG - Intergenic
1069252690 10:66290085-66290107 AAGGAAAGAAGGATAGTAGTAGG + Intronic
1069880754 10:71591434-71591456 CTGGACACAAGGAGAGCTGCTGG + Intronic
1070950531 10:80427486-80427508 CAGGAAAGCAGGTGAGTTCTTGG + Exonic
1071995998 10:91150015-91150037 GTCTAAAGAAGGAGAGTTGGTGG + Intergenic
1072221516 10:93331396-93331418 CTGGAAGGAAGGGGTGCTGTAGG - Intronic
1072652647 10:97307657-97307679 GTGGGAAGAAGGAGAGTGGGAGG + Intergenic
1074976364 10:118585109-118585131 CTGCACTGAAGGAGAGTTGCTGG + Intergenic
1075966571 10:126616925-126616947 CTGGTTAGAAGGGGAGGTGTGGG - Intronic
1076082737 10:127598332-127598354 CTGAAAAGAAGGAAAGTTGTAGG + Intergenic
1076229940 10:128811780-128811802 CTGGAAAGAAAGATGGTTTTCGG + Intergenic
1076563787 10:131384707-131384729 CTGGAGAGAAGGTGAGTGCTTGG - Intergenic
1077609732 11:3636926-3636948 CTGGAAAGAAGGAAAGTCTGGGG - Intergenic
1077701409 11:4445403-4445425 CTGGAAAGAGGGAAAGCTGATGG + Intergenic
1078246870 11:9581581-9581603 CTTTAAAGAAGCAGAGTTGAAGG + Exonic
1078622205 11:12918987-12919009 CTGGAAGGAAGGATATTTGGGGG + Intronic
1078663487 11:13305857-13305879 CTTGAAACAGGGAGATTTGTTGG + Intronic
1080769180 11:35324820-35324842 CTGGAAATAAGCAAATTTGTTGG - Intronic
1081591722 11:44427750-44427772 CTGGAAAAAAGGAGGGTTGGAGG - Intergenic
1083159099 11:60843695-60843717 CTGCCATGAAGGAGAGGTGTGGG + Intronic
1083643190 11:64156692-64156714 CTGGAGAGAAGGGGCTTTGTGGG - Intronic
1085953632 11:81364418-81364440 CTGGATAGAAGAAGATTTGGAGG + Intergenic
1086527949 11:87751128-87751150 CTTGAAAGAAGTAGAGTTGTAGG + Intergenic
1086762785 11:90654081-90654103 CTAGAAAGAAGGTAAATTGTGGG - Intergenic
1086857534 11:91883387-91883409 TGGGAAAGAAAGAGATTTGTAGG - Intergenic
1086893639 11:92287557-92287579 CTGTCAAGAAGTAGAGTTGTAGG + Intergenic
1087002586 11:93435661-93435683 CTGGAAAGAAAGAGCTGTGTAGG - Intronic
1088353478 11:108916377-108916399 CTGGAAAGAAATTGAGTTGGGGG - Intronic
1088567263 11:111185044-111185066 GTAGAAAGAAGGATAATTGTTGG + Intergenic
1090538875 11:127678483-127678505 TAGGAAAGAAGGAAAGTTGGCGG - Intergenic
1090602479 11:128387491-128387513 CTGGAAAGCAGGAGACTGATTGG + Intergenic
1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG + Intergenic
1091382051 12:67975-67997 CTGAAAAGCAGGAGTGATGTGGG + Intronic
1091712498 12:2752023-2752045 CTGAAAAGCAGGAGTGATGTGGG - Intergenic
1092443459 12:8530351-8530373 CTAGAAATAATGATAGTTGTGGG - Intergenic
1092500369 12:9040114-9040136 CTGAAAAGTAGGAGAGAAGTAGG + Intergenic
1092727840 12:11501573-11501595 CTGAAAAGCAGGAGTGATGTGGG + Intergenic
1095254780 12:40022164-40022186 CTGGAAAGCAAGAGTATTGTAGG - Intronic
1095927649 12:47595004-47595026 ATAGAAAGATGGAGAATTGTTGG + Intergenic
1096064659 12:48730002-48730024 CTGGAAAAAGGGAAATTTGTAGG - Intergenic
1096114987 12:49050465-49050487 CTGGGAAGGAGGGGAGTTTTGGG + Exonic
1096484745 12:51971473-51971495 CTTGGAATAAGGAGAGTTTTAGG + Intronic
1097247082 12:57612578-57612600 ATTGAAAGAGGGAGGGTTGTAGG + Intronic
1097650994 12:62297063-62297085 CAGGAAGGAAGGAGAGGAGTGGG + Intronic
1098131440 12:67354648-67354670 CTGGAAAGAGGCAGAGCTGAGGG + Intergenic
1098363336 12:69676927-69676949 CTGCATAGAAGAAGAATTGTAGG + Exonic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1099584214 12:84495476-84495498 GTAGAAAGAAGGGGAGTTTTAGG - Intergenic
1100029122 12:90164337-90164359 ATGAAAAGAAGGAGGGCTGTTGG - Intergenic
1100286872 12:93174966-93174988 CTGGAAATAAGGTGATGTGTAGG + Intergenic
1100368933 12:93947343-93947365 CTGATAAGAAGGAGATTAGTAGG - Intergenic
1101241934 12:102847795-102847817 CTTGAAGGAAGTGGAGTTGTTGG + Intronic
1101429777 12:104617218-104617240 CTGGAGTGAAGGGGATTTGTGGG + Intronic
1102716076 12:114973979-114974001 AGGGAAAGAAGGTCAGTTGTGGG - Intergenic
1102738293 12:115182606-115182628 CTGGAAATCAGGGGTGTTGTCGG + Intergenic
1104365296 12:128171193-128171215 CAGGAAAGATGGAGATTTGAGGG + Intergenic
1104491235 12:129195293-129195315 GTGGCCAGAAGGAGAGTTGCAGG + Intronic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1105859332 13:24395254-24395276 CTGGAGAGGAGGAGAGGGGTTGG - Intergenic
1105916198 13:24919014-24919036 CTGGAAAGAAGGAGGGTGAGGGG + Intronic
1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG + Intronic
1107063896 13:36191385-36191407 ATGGGAAGAAGCAGAGTAGTAGG + Intronic
1107866820 13:44711078-44711100 GTGGAAAGAATGAGAGTTCTGGG - Intergenic
1107996251 13:45864158-45864180 CTGGCAACAAGGAGGGTGGTGGG + Intergenic
1108959884 13:56213489-56213511 CTGAGAAAAAGGAGAGTTGATGG - Intergenic
1109719869 13:66261765-66261787 CTGGAAAGAGACAGACTTGTTGG - Intergenic
1110906749 13:80898983-80899005 CTGGAAGGAAGGAGAAATGGGGG + Intergenic
1112027014 13:95420411-95420433 GTGGAAAGAAGGAGGGATGGAGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114512785 14:23276349-23276371 CTGGAAAGAAGAAGAGGTAGAGG + Exonic
1115842080 14:37483413-37483435 AAGGAAAGAAGGATTGTTGTTGG - Intronic
1120093009 14:80355801-80355823 TTGGAAAGATGGAGGGTAGTGGG - Intronic
1120324496 14:83007744-83007766 CTGAGATGAAGGAGAGTTGGAGG + Intergenic
1121237127 14:92400138-92400160 CTGGAAAAAATCAGAGTTGGAGG + Intronic
1121695038 14:95905284-95905306 CTGGATGGAAGGACATTTGTGGG - Intergenic
1121731424 14:96189750-96189772 CTGGAAGGCAGGAGGGTTATAGG + Intergenic
1122011230 14:98750655-98750677 AGGGACAGAAGAAGAGTTGTTGG - Intergenic
1122024760 14:98867688-98867710 CTGGAAAGAATCAGATTTGCAGG - Intergenic
1122651825 14:103230607-103230629 CAGGAAGGAAGGAGAGAGGTGGG + Intergenic
1125189414 15:36972675-36972697 TTGGAAACCAGGAGAGGTGTTGG - Intronic
1125448499 15:39783352-39783374 CTGGAAAGCAGGAGAAATGATGG - Intergenic
1126010702 15:44299608-44299630 CTGGAAAGAACAAGGGTTTTTGG + Intronic
1126129352 15:45325545-45325567 CTGGAGAGAAGGAGAATTTGAGG - Intergenic
1127067984 15:55260311-55260333 CAGCAATGAAGGAGAGTTCTGGG - Intronic
1127819552 15:62643049-62643071 CTGGCAAAAAGGACACTTGTTGG - Intronic
1128069319 15:64784354-64784376 CTGGAAAAAAGAAGATTTCTGGG + Intergenic
1128693643 15:69744328-69744350 CAGGAAAGGAGGAGGGTGGTGGG + Intergenic
1129430971 15:75501796-75501818 CTGGAGAGAAAGAGATTTCTGGG + Intronic
1129798896 15:78398622-78398644 CTGGAAAGAATGAGAATCCTGGG - Intergenic
1133089205 16:3390354-3390376 CTGGAAAGGAGGAGGGTTTTGGG + Intronic
1134078141 16:11306724-11306746 CCGGAAAGAAGGATTCTTGTTGG - Intronic
1134776698 16:16859513-16859535 CTGGAAAGAGGGAGTCGTGTAGG - Intergenic
1134862628 16:17574285-17574307 ATGGAAGGAAGAAGAGTTATTGG + Intergenic
1135383443 16:22013409-22013431 AGGGAAAGAAGGAGACTTGGGGG + Intronic
1135852117 16:25973208-25973230 CTGGAAAGCAGGACACTTGAAGG + Intronic
1139021259 16:62752937-62752959 ATGGAAAGCAGGAGAATTGACGG - Intergenic
1139035511 16:62941418-62941440 CTGGAAAGAGGGAGAGGTTCAGG - Intergenic
1139168091 16:64594903-64594925 CTGAAAACAAGGAGGGTTGGTGG - Intergenic
1139282913 16:65785297-65785319 ATGAAAAGAAGGTGAGATGTAGG + Intergenic
1139334855 16:66224554-66224576 CTGAAAAGTAGGACATTTGTGGG - Intergenic
1141392432 16:83676067-83676089 CAGGAAAGAAGGAGAGGAGGAGG + Intronic
1143244010 17:5468129-5468151 ATGAAAAGAGGCAGAGTTGTGGG - Intronic
1143977043 17:10837679-10837701 CTGGGAAGAAGGGAATTTGTGGG - Intronic
1144334607 17:14257533-14257555 TTGGAAGGAAAGAGAGCTGTTGG - Intergenic
1145413436 17:22693786-22693808 CTTTAAAGAAGCAGAGTTGAAGG - Intergenic
1145414719 17:22704974-22704996 CTTCAAAGAAGCAGAGTTGAAGG + Intergenic
1146784686 17:35709004-35709026 CTGGAAGGAGGTAGAGTTGCAGG + Intronic
1147606397 17:41776071-41776093 CTGGAAATAAGGACAGGAGTGGG + Intronic
1149045955 17:52245956-52245978 CTGGAGAGAAAGAGAGTGCTGGG - Intergenic
1149505745 17:57192423-57192445 CAGAAAAGAAGGACAGGTGTGGG + Intergenic
1150856736 17:68760313-68760335 CTGGAAAGTTGGAAATTTGTAGG + Intergenic
1152332885 17:79683762-79683784 TTGCCAAGAAGGAGAGTTGTCGG - Intergenic
1153815038 18:8784284-8784306 CGGGCAAGAAGGAGAGTGATGGG + Exonic
1153917158 18:9756318-9756340 CAGGAAAGCAGGTAAGTTGTGGG + Intronic
1154043973 18:10887023-10887045 CAAGAGAGACGGAGAGTTGTGGG + Intronic
1155061281 18:22231104-22231126 CTGGTAAGCAGGAGAATTGCTGG + Intergenic
1155791830 18:29981663-29981685 CTTTTAAGAAGGAGAGTTATGGG + Intergenic
1156115666 18:33784562-33784584 GTGGAAAGATGGAGAGTTTCAGG + Intergenic
1157276044 18:46311806-46311828 TTGGAAAGGAGGAGCCTTGTGGG + Intergenic
1158227882 18:55219261-55219283 CTGTAAAGAAGTAGACTTGTAGG - Intergenic
1158257215 18:55565136-55565158 CTGGGAAGAATGGGAGTTATAGG + Intronic
1160082713 18:75744681-75744703 CTGGAAAGAATGAGCGCCGTTGG - Intergenic
1161295978 19:3520338-3520360 CTGGAAGGAGGGAGAGCTGCTGG + Intronic
1162478771 19:10915992-10916014 CTGGACAGAGGGAGGGTGGTGGG - Intronic
1162606875 19:11715856-11715878 CAGGAAAAAATGAAAGTTGTTGG - Intergenic
1163068397 19:14816811-14816833 CTGGAAGGCAGGTGAGTTATTGG + Intronic
1163078664 19:14919379-14919401 CTGGAAAGCAGAAGAGTTCATGG + Intergenic
1164484430 19:28642700-28642722 CTAGAATGAAGGTGAGATGTGGG - Intergenic
1164585625 19:29473054-29473076 AGGGAAAGAAGGAGAGATGTTGG - Intergenic
1166380945 19:42354975-42354997 CTGGAAAGAGTGAGTGGTGTGGG - Intronic
1167378289 19:49123960-49123982 CTGGAAATAAGGACATTTCTAGG - Intronic
1167979810 19:53265604-53265626 TTGGAAAGAAAGAGATTTGGGGG - Intergenic
1168471496 19:56643850-56643872 CTGGGCACAAGGAGAGTTCTGGG + Intronic
926316865 2:11716238-11716260 CGGGATAGAAGGAGAGGTGTGGG - Intronic
926401207 2:12498941-12498963 TTGGAAAGCAGGAAAGTTATGGG + Intergenic
926885042 2:17589421-17589443 CTGTGCAGAAGGAGAGTGGTTGG + Intronic
927281888 2:21316034-21316056 ATGAAAAGAAGTGGAGTTGTGGG + Intergenic
928394403 2:30932491-30932513 CTGGAAAGGAGGAGCCTTGGGGG + Intronic
928843745 2:35643628-35643650 CTGGAAAGATTGAGAGTTGAAGG + Intergenic
929767131 2:44854360-44854382 CTGGAGAGAAAGAGAGATGTGGG + Intergenic
931009418 2:57891525-57891547 GTGGATAGAGGGAGAGTTGAGGG + Intergenic
931206357 2:60149377-60149399 ATGGAATGAAGGAGGGTGGTAGG - Intergenic
932356760 2:71073691-71073713 CAGGAAATAGGGTGAGTTGTGGG + Intronic
932887810 2:75562707-75562729 CTGGAAAGCTGGAGAGTTAGGGG - Intronic
933937195 2:87216421-87216443 CAGGTAAGGAAGAGAGTTGTTGG - Intergenic
934030661 2:88043025-88043047 CCCGTAAGAAGGAGAGTAGTAGG - Intronic
934056325 2:88254199-88254221 AAGGAAAGAAGGAGAGTAGGAGG + Intergenic
934783063 2:96985263-96985285 CTGGAAAGAATGTGAGATGGAGG - Intronic
934858239 2:97742072-97742094 CTGGAAACAAAGAGAGGTTTTGG + Intergenic
935017660 2:99199581-99199603 CTGGAAAAAAGAAAATTTGTTGG + Intronic
935042514 2:99446845-99446867 GTGGACAGGAGGAGAGTTGAGGG - Intronic
935088107 2:99867997-99868019 AAGGAAAGAAAGAGAGTCGTGGG - Intronic
935417193 2:102831454-102831476 CTTAAAAGAAGAAGAGTGGTGGG + Intronic
936010538 2:108922525-108922547 CTGGAAAGAAGGGGAGGAGCAGG - Intronic
936017901 2:108973452-108973474 CTGGAAAGCAGGAGAAATGAAGG - Intronic
936355948 2:111749403-111749425 CAGGTAAGGAAGAGAGTTGTTGG + Intergenic
936851541 2:116905049-116905071 CTGAAAAGAAGCAGAGATCTAGG - Intergenic
937044617 2:118844616-118844638 CTGGAAAGAAGGATCTTTGCCGG + Intronic
937079198 2:119128235-119128257 CTGGGAAGATGGAGGGTTCTGGG - Intergenic
937257141 2:120563620-120563642 TTGGCTAGAAGGAGAGTTCTAGG + Intergenic
937502372 2:122493483-122493505 CTGGATAAAAGGACAGCTGTTGG - Intergenic
937759317 2:125581407-125581429 CTGGGAAGAAGGAGACATTTAGG - Intergenic
937878286 2:126843311-126843333 GTGGAAAGAAATAGAGCTGTTGG - Intergenic
938986169 2:136578759-136578781 TTGGAAAGAATGTGAGCTGTGGG + Intergenic
941360837 2:164549466-164549488 CTGAAGAGAATGAAAGTTGTCGG - Intronic
941485795 2:166080516-166080538 TTGGAAATAAGTAGAGTAGTGGG + Intronic
941743961 2:169066561-169066583 CTTGAAAGAAGGAAAGGTGAAGG - Exonic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
944185024 2:196938653-196938675 CTTGTAAGAAGGATGGTTGTGGG + Intergenic
944592828 2:201233993-201234015 CTGGAAGGAAGGAGAGATGACGG - Intronic
944851314 2:203722219-203722241 CTGAAAAGGAGGAGAGATGCAGG + Intronic
945522469 2:210845352-210845374 CAGGAATGAAGAAGAGTAGTAGG - Intergenic
945808610 2:214520645-214520667 CTGGCAAGTGTGAGAGTTGTGGG - Intronic
945930196 2:215847178-215847200 CTGGAAGGAAGAAGGGTTGAAGG + Intergenic
946226303 2:218265770-218265792 CAGGAAGGAAGGAGAGGAGTCGG + Intronic
946503763 2:220277248-220277270 CTGTAAAGAGAGAGAGATGTTGG - Intergenic
947425647 2:229980761-229980783 CTGGACAGCAGGAGAGTTGAGGG + Intronic
947706698 2:232282099-232282121 CTGGAAAGACAGAGAGTAGGAGG - Intronic
1169711761 20:8572314-8572336 CTGGAAAGAAGGGGAACTCTGGG + Intronic
1169845289 20:9984300-9984322 TTGGAAAGTAGGACAGTTGTAGG - Intergenic
1170038267 20:12012914-12012936 CTGGAAAGATCGAGAGTGGCTGG + Intergenic
1171884028 20:30638936-30638958 CTGGAAACAGTGAGAGGTGTGGG - Intergenic
1172055455 20:32151338-32151360 CTGGAGGTAAGGAGAGTTCTTGG + Intronic
1172803077 20:37591860-37591882 TTGGAATGAAGGAGGGTTCTGGG - Intergenic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1174311933 20:49663197-49663219 CTGGAGTGCAGGAGAGTTGAAGG + Intronic
1174754056 20:53140797-53140819 CTGGGAAGAGGGAGAGCTTTGGG + Intronic
1176254857 20:64146627-64146649 CTTGAGAGAAGGAGAGATGGGGG - Intergenic
1176283151 20:64326858-64326880 CTGAAAAGCAGGAGTGATGTGGG - Intergenic
1176906896 21:14511981-14512003 CAGGAAAAAAGGAAAGTGGTCGG + Intronic
1177101866 21:16907927-16907949 CTGGAAAGGAGGAGTGGTGGGGG + Intergenic
1178763455 21:35426626-35426648 TTGGAACGAAGGAGAGCAGTGGG - Intronic
1178805422 21:35835427-35835449 CTGGAGACCAGGACAGTTGTTGG + Intronic
1179296267 21:40065650-40065672 CTGGAAGGCAGGAGAGTACTGGG - Intronic
1179958209 21:44752644-44752666 CAGGAAGGAAGGAGAGTGGGAGG + Intergenic
1181895153 22:26100672-26100694 ATGGCAAGAAGGGGATTTGTAGG - Intergenic
1182489877 22:30664486-30664508 CTGGAAGGAAGGAGAGAATTTGG - Intronic
1182717266 22:32367557-32367579 CTGGAAAGAACGAGAATTTGGGG - Intronic
1183545858 22:38454724-38454746 CTGGAAAGGGGGAGAGAGGTGGG - Intronic
1183578135 22:38705531-38705553 CTGGAAACAAGGAGAGTGAAGGG + Intergenic
1183955766 22:41380075-41380097 CTGGAAAGCAAGAGATTTGAAGG - Intronic
949369770 3:3322159-3322181 CTGCAATGAAAGAGAGTTCTAGG + Intergenic
952533232 3:34283787-34283809 CTGGAAAGAACCAGCGTTATGGG + Intergenic
952621008 3:35342432-35342454 ATGGAAAGAAGGAAAGATGGAGG + Intergenic
952621678 3:35351692-35351714 CTGGTTAGTTGGAGAGTTGTAGG - Intergenic
955460949 3:59182713-59182735 CTAGAAAGAAGTAGAGTTAAGGG + Intergenic
955622369 3:60878078-60878100 TGGGAAAGAAGCAGAGTTTTAGG - Intronic
958832094 3:99101571-99101593 CTGAGAACAAGGAGAGTTGAAGG + Intergenic
958985462 3:100775599-100775621 GAGGAAAGATGGAGGGTTGTCGG + Intronic
961659421 3:128460609-128460631 CTGGAATGAAGGTGAGGTGCTGG - Intergenic
961768192 3:129228656-129228678 AGGAAAAGAAGGAGAGCTGTGGG - Intergenic
961912226 3:130329884-130329906 CTGGAAAGAAGGAAAGAGGGGGG + Intergenic
962933871 3:140061502-140061524 CTGGAAAGAAGCAGGGCTGGTGG - Intronic
963211964 3:142702769-142702791 CTGGAAAGAAGTATTGTGGTTGG + Intronic
963265852 3:143239256-143239278 CTGGAATGAAGGGAATTTGTTGG + Intergenic
963322780 3:143827543-143827565 CTGGAAAATATGAGAGCTGTTGG - Intronic
963637531 3:147817502-147817524 CTGGAAAGTATGAGATATGTGGG + Intergenic
964006175 3:151831971-151831993 GAGTAAATAAGGAGAGTTGTAGG + Intergenic
964191314 3:154004311-154004333 CGGGAAAGAAGGTGAATTTTGGG - Intergenic
964764954 3:160170694-160170716 CTGGAAAGAATGAGATGTGTTGG - Intergenic
964787491 3:160414227-160414249 CTTGGAATAAGGAGAGTTTTAGG + Intronic
965398159 3:168185904-168185926 CAGGAAAAATGGAAAGTTGTGGG - Intergenic
966043226 3:175518013-175518035 CTGGAAAGGAGGAGAGAAGATGG + Intronic
967674776 3:192283909-192283931 CAGGAAAGAAGGAGAATTTCAGG - Intronic
967715353 3:192756319-192756341 CTGGGAAGAAGGAGTGTGGTGGG + Intronic
968382181 4:106668-106690 CTTTAAAGAAGCAGAGTTGAAGG - Intergenic
970038753 4:11771958-11771980 ATGGAAAAAAGGAGATTTGAGGG + Intergenic
971493164 4:27235961-27235983 ATGGAAAGAATGAGAGCAGTTGG + Intergenic
973951095 4:56015229-56015251 ATGAAAAGAAGGAAGGTTGTTGG + Intronic
975702937 4:77083891-77083913 CTGGAAACAAGGAGGGTGGGGGG + Intergenic
976146794 4:82049949-82049971 CTGGGAGGAGGGAGAATTGTAGG - Intergenic
976410767 4:84711111-84711133 CTGGAAAGAAGCAGTGCTTTGGG - Intronic
977008449 4:91603671-91603693 TTGGAAAGAATGAAAGATGTAGG - Intergenic
977137299 4:93321448-93321470 ATGGAAAGAAGGATATTTTTAGG + Intronic
977740208 4:100470954-100470976 ATGGAAAGAAGGAAATTTATAGG + Intronic
978783979 4:112588778-112588800 CTGGAAAGTAGCAGAGCAGTAGG + Intronic
978815534 4:112900663-112900685 ATGGAAAGAGGGAGACTTGAAGG - Intronic
979527952 4:121737096-121737118 GTGAAAAGAAAGGGAGTTGTAGG + Intergenic
979695968 4:123613262-123613284 CTGGAAAAAAAGAAAGTTTTTGG + Intergenic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
985902671 5:2808838-2808860 AAGGAAGGAGGGAGAGTTGTAGG + Intergenic
988027706 5:25720172-25720194 GTGCAAATAAGGAGAGTTGGAGG - Intergenic
990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG + Intergenic
991291361 5:65036158-65036180 CTGCAAAGAAAGGGGGTTGTGGG - Intergenic
992711588 5:79463509-79463531 CTGGAGATAAGGTGATTTGTTGG - Intronic
994027703 5:95104004-95104026 CTGATATGATGGAGAGTTGTGGG - Intronic
994103890 5:95923979-95924001 CAGGAAAGCAGGAGACTTATTGG + Intronic
994899626 5:105754321-105754343 CTGGAGAGGAGGAGGGTTGCTGG - Intergenic
995836927 5:116408546-116408568 CAGGAAATATGGAGAGATGTTGG - Intronic
995845642 5:116490996-116491018 GTGGAAAGAAGGAGTAGTGTTGG + Intronic
996705886 5:126497990-126498012 CAGGAGAGAAGTAGATTTGTTGG + Intergenic
998472414 5:142393444-142393466 CAGGACATAAGAAGAGTTGTGGG + Intergenic
999409684 5:151340015-151340037 AAGGGAAGAAAGAGAGTTGTGGG + Intronic
999618626 5:153451486-153451508 CAGGAAAGAAGGAAATTTGGGGG + Intergenic
1000966826 5:167667604-167667626 CAGGAAAGAAGGAGGGAGGTTGG + Intronic
1001612518 5:173014714-173014736 TGGGAAGGAAGGAAAGTTGTGGG + Intronic
1002041966 5:176521151-176521173 CTGGAAGGGAGGAGAGAGGTGGG + Intergenic
1002696171 5:181092614-181092636 CTGGATCTAAGAAGAGTTGTTGG - Intergenic
1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG + Intergenic
1004191735 6:13470225-13470247 CTGGAAAGAAGGGCAATTGCCGG + Intronic
1004318136 6:14609667-14609689 CAGCAAAGAAAGAGAGGTGTGGG + Intergenic
1004378847 6:15114929-15114951 CTGGACAGAAATAGAGTTATAGG + Intergenic
1004753163 6:18584226-18584248 CTGGAAAGAAGGAGAGGCAATGG + Intergenic
1005024605 6:21450498-21450520 TTGGAAAGGAGGAAAGTTGTAGG - Intergenic
1005534785 6:26744416-26744438 AGAGAAAGAAGGAGAGTGGTGGG + Intergenic
1006045110 6:31288473-31288495 CTGGAAAGAAGAAGTGCTGCAGG - Intronic
1006147711 6:31969254-31969276 CAGGAAAGAAGGAGAGGTTAAGG - Intronic
1007013804 6:38442612-38442634 CTGTGAAGAAGGAAAGTTGGAGG + Intronic
1007489556 6:42208508-42208530 ATGGAAAGAAGGAAACTTGATGG + Intronic
1009640805 6:66333493-66333515 CAGCAAAGTAGGAGAGTTTTAGG - Intergenic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1012619524 6:101323804-101323826 GTGGAAAGAAGGAGAGGATTAGG + Intergenic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1015083833 6:129263542-129263564 CTGGAAAGAAGGAGCGTGGCTGG + Intronic
1015945930 6:138501048-138501070 TTAGACACAAGGAGAGTTGTGGG + Intronic
1016657747 6:146541529-146541551 TTGGAAAGTAGTAGACTTGTGGG - Intergenic
1018540179 6:164871114-164871136 CTGGAAAGATAAAGAGCTGTAGG - Intergenic
1018724706 6:166602975-166602997 CTGGAGAGAGAGAGAGGTGTTGG + Intronic
1020967312 7:14887533-14887555 CTGAAATTAAGGGGAGTTGTTGG - Intronic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1023537050 7:41224800-41224822 ATGGAAAGATGGAGAGATTTAGG + Intergenic
1023682460 7:42701537-42701559 CTGAGAAGCAGGAGAGTTGATGG + Intergenic
1025777742 7:64573934-64573956 TTGGAACGAAAGAGAGATGTTGG + Intergenic
1027448688 7:78304214-78304236 CTGGAAAGCTGTGGAGTTGTAGG - Intronic
1027469328 7:78553906-78553928 CCCAAAAGAAGGAGAGATGTGGG + Intronic
1027548875 7:79565553-79565575 CTGGAAATAATCAGAGTAGTAGG + Intergenic
1028880695 7:95876339-95876361 CTGGACAGAAGGAGTGATCTTGG + Intronic
1029047190 7:97642464-97642486 CTGGAATGAAAGGGAGATGTTGG - Intergenic
1029402601 7:100355292-100355314 GAGGAAAGGAGGATAGTTGTTGG + Intronic
1030435793 7:109518357-109518379 GTGGAAAGAAGGGGAAATGTTGG + Intergenic
1030815992 7:114038387-114038409 ATTGAAAGAAGAAGAGTTTTTGG - Intronic
1030990512 7:116293342-116293364 CAGGCAAGCAGGAGAGTTGCAGG + Intronic
1031373558 7:120997047-120997069 CCTGACAGAAGGAGAGATGTGGG - Intronic
1031847307 7:126821614-126821636 CTGAAAGGAAGGAGAGTGATGGG - Intronic
1032468040 7:132159130-132159152 CTGGAAAGAAGGGGATTTAAGGG - Intronic
1032946657 7:136861592-136861614 CTGGAGATAAGGAAAGTTTTAGG + Intergenic
1034760146 7:153664743-153664765 TGAGAAAGAAGGAGAGTGGTAGG + Intergenic
1036664917 8:10731717-10731739 CTGGAAGGAGGCAGCGTTGTGGG + Intronic
1037486938 8:19356703-19356725 CAGGAAAAGAGGAGAATTGTGGG + Intronic
1037779378 8:21857291-21857313 CTATAAAGAAGGAGAGTGCTGGG + Intergenic
1039427398 8:37496909-37496931 CTAGAAAGAAGGAGAGAGGGAGG + Intergenic
1039852755 8:41384560-41384582 CTGGAATGAAGTAGGGTTGAGGG - Intergenic
1040547453 8:48409769-48409791 CTGGGAAGGAGGAGAGTAGGTGG + Intergenic
1040859434 8:51984009-51984031 CTGGAGAGAAAGGAAGTTGTGGG - Intergenic
1041687275 8:60655641-60655663 GTGGAAAGAGGGTGAGATGTGGG + Intergenic
1043176897 8:77032909-77032931 CAAAAAAGAAGGAGAGTTGGAGG + Intergenic
1046182243 8:110666174-110666196 CTAAAAAGAAGGAGAGAAGTGGG - Intergenic
1046564097 8:115876492-115876514 CTTGGAAGAAGCAGAGTTGTTGG - Intergenic
1046737467 8:117792279-117792301 CTATAAAGAAGGAGACTTGGAGG - Intergenic
1046909248 8:119607703-119607725 ATGGAAAAAAGGAGAGCTGGAGG + Intronic
1047050608 8:121107512-121107534 TTAGAAAGAAGTAGAGATGTGGG - Intergenic
1047066014 8:121284048-121284070 CGGGAGAGAAGGAGAGATGCAGG - Intergenic
1047516231 8:125556880-125556902 GTGGAAAGAAATAGAGATGTGGG + Intergenic
1047825251 8:128566123-128566145 TTGGAAAAAAGGAGGGTTGTTGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048394775 8:134003521-134003543 CTGGAAAGAAGGGGAATTCATGG - Intergenic
1048420521 8:134274057-134274079 CTGGACCCAAGGAGAGTAGTTGG + Intergenic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049384073 8:142332034-142332056 CTGGAAGGAAGGAGAGACGAAGG + Intronic
1050335028 9:4582520-4582542 ATGGACAGAAGGATAGTTGTAGG - Intronic
1050437704 9:5628181-5628203 CTGAATAGAAGGAGGGTTGAGGG - Intergenic
1050528559 9:6567037-6567059 CTCCAAGGACGGAGAGTTGTGGG + Intronic
1052407437 9:28080088-28080110 TTGGAAATAATGAGAGATGTTGG - Intronic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1054785508 9:69206386-69206408 CTGGAAGGAGGGCGAGTTGAAGG - Intronic
1054898201 9:70337794-70337816 CTGGAAAGTAGGAAAGTTTTTGG + Intronic
1055288346 9:74755474-74755496 CTGGAGAGAAAGACACTTGTTGG + Intronic
1055463902 9:76544977-76544999 GTGGAAGGAAGGCCAGTTGTGGG + Intergenic
1055865850 9:80812263-80812285 CTGAAGAGAAGAAGAGTTGAAGG + Intergenic
1056888619 9:90468516-90468538 CTGGGAAGAAGTCCAGTTGTTGG - Intergenic
1060122670 9:121009471-121009493 CTGGAATGAGGGAGAGTTCCAGG + Intronic
1060222400 9:121771701-121771723 CAGGAAAGACGGAGAGCAGTGGG - Intronic
1060493989 9:124104669-124104691 CTGGATAAGAGGAGAGTTTTGGG - Intergenic
1187334860 X:18373217-18373239 CGGGAGAGAAAGGGAGTTGTGGG - Intergenic
1187984522 X:24796063-24796085 CTGGAGAGGAGGAGAGAGGTGGG - Intronic
1188429307 X:30087995-30088017 CTTGAAAGAAGCTGAGGTGTGGG - Intergenic
1188922413 X:35993546-35993568 CTTTAAAGAAGTAGAGTTTTTGG + Intergenic
1189000607 X:36940412-36940434 CTGGAAAGAAGTAGAGTGGTGGG - Intergenic
1191972244 X:66829531-66829553 ATGGAAAAAAGGAGACTGGTTGG - Intergenic
1192174148 X:68875406-68875428 CAGGCAAGGAGGAGAGTGGTAGG + Intergenic
1192402809 X:70853938-70853960 CTGGACAGAAACAGAGTTCTAGG + Intronic
1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG + Intergenic
1192729029 X:73783746-73783768 CTGGAAAGTAAAAGAGTTGGTGG - Intergenic
1193473687 X:81937561-81937583 CTGAAAAGAAACAGAGTAGTAGG - Intergenic
1195114777 X:101686247-101686269 CAGGAAAGAAGGAGTGGTGCAGG + Intergenic
1196440707 X:115717608-115717630 CTGGAAAGAAGGGGAGGGGAGGG - Intergenic
1197622795 X:128769880-128769902 CTAGAAGTAAGGAGAGATGTGGG - Intergenic
1198279019 X:135124097-135124119 CTGGCTAGAAGTAGAATTGTAGG - Intergenic
1198291939 X:135248423-135248445 CTGGCTAGAAGTAGAATTGTAGG + Intergenic
1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG + Intronic
1198682328 X:139196058-139196080 AGGGAAAGAAGGAGAGTCGGAGG + Intronic
1198896424 X:141460630-141460652 GAGGAAAGAAAGAGAGGTGTAGG + Intergenic
1200088463 X:153623398-153623420 CTGGCAGGAAGCAGAGTGGTGGG - Intergenic
1201401083 Y:13604610-13604632 CTGGCAAGTAGGACAGTGGTTGG + Intergenic