ID: 1098992308

View in Genome Browser
Species Human (GRCh38)
Location 12:77077246-77077268
Sequence GGGGCCACACAGATATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098992308_1098992317 27 Left 1098992308 12:77077246-77077268 CCACCAAATATCTGTGTGGCCCC No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098992308 Original CRISPR GGGGCCACACAGATATTTGG TGG (reversed) Intergenic
No off target data available for this crispr