ID: 1098992317

View in Genome Browser
Species Human (GRCh38)
Location 12:77077296-77077318
Sequence ACGACAAAGTCCAGCAACTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098992313_1098992317 6 Left 1098992313 12:77077267-77077289 CCTTCCCTAAAGGAGACAAAGTT No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data
1098992309_1098992317 24 Left 1098992309 12:77077249-77077271 CCAAATATCTGTGTGGCCCCTTC No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data
1098992312_1098992317 7 Left 1098992312 12:77077266-77077288 CCCTTCCCTAAAGGAGACAAAGT No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data
1098992314_1098992317 2 Left 1098992314 12:77077271-77077293 CCCTAAAGGAGACAAAGTTCCAG No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data
1098992308_1098992317 27 Left 1098992308 12:77077246-77077268 CCACCAAATATCTGTGTGGCCCC No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data
1098992315_1098992317 1 Left 1098992315 12:77077272-77077294 CCTAAAGGAGACAAAGTTCCAGC No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data
1098992311_1098992317 8 Left 1098992311 12:77077265-77077287 CCCCTTCCCTAAAGGAGACAAAG No data
Right 1098992317 12:77077296-77077318 ACGACAAAGTCCAGCAACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098992317 Original CRISPR ACGACAAAGTCCAGCAACTC CGG Intergenic
No off target data available for this crispr