ID: 1098992569

View in Genome Browser
Species Human (GRCh38)
Location 12:77080117-77080139
Sequence CTGAATATACAGACAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098992569_1098992570 -2 Left 1098992569 12:77080117-77080139 CCTTTTTTTGTCTGTATATTCAG No data
Right 1098992570 12:77080138-77080160 AGTGCTGTGTGTCCAGTGCCTGG No data
1098992569_1098992573 29 Left 1098992569 12:77080117-77080139 CCTTTTTTTGTCTGTATATTCAG No data
Right 1098992573 12:77080169-77080191 TGCCATGTATGAGACACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098992569 Original CRISPR CTGAATATACAGACAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr