ID: 1098994469

View in Genome Browser
Species Human (GRCh38)
Location 12:77102991-77103013
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098994467_1098994469 7 Left 1098994467 12:77102961-77102983 CCATTTCTTCAGCATATCAAATC No data
Right 1098994469 12:77102991-77103013 CAGGCTCAACACCCTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098994469 Original CRISPR CAGGCTCAACACCCTTGAAG TGG Intergenic
No off target data available for this crispr