ID: 1099003225

View in Genome Browser
Species Human (GRCh38)
Location 12:77205846-77205868
Sequence CAATATACAACAGTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099003225_1099003232 18 Left 1099003225 12:77205846-77205868 CCCAGTTCCACTGTTGTATATTG No data
Right 1099003232 12:77205887-77205909 AACTTATCTGTTTAGATCATGGG No data
1099003225_1099003231 17 Left 1099003225 12:77205846-77205868 CCCAGTTCCACTGTTGTATATTG No data
Right 1099003231 12:77205886-77205908 TAACTTATCTGTTTAGATCATGG No data
1099003225_1099003233 25 Left 1099003225 12:77205846-77205868 CCCAGTTCCACTGTTGTATATTG No data
Right 1099003233 12:77205894-77205916 CTGTTTAGATCATGGGTCTCTGG No data
1099003225_1099003229 -10 Left 1099003225 12:77205846-77205868 CCCAGTTCCACTGTTGTATATTG No data
Right 1099003229 12:77205859-77205881 TTGTATATTGAATGCAATGAGGG No data
1099003225_1099003230 -6 Left 1099003225 12:77205846-77205868 CCCAGTTCCACTGTTGTATATTG No data
Right 1099003230 12:77205863-77205885 ATATTGAATGCAATGAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099003225 Original CRISPR CAATATACAACAGTGGAACT GGG (reversed) Intergenic
No off target data available for this crispr