ID: 1099014132

View in Genome Browser
Species Human (GRCh38)
Location 12:77324962-77324984
Sequence GAGGCGCGGCCCGGCGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 1, 2: 2, 3: 66, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099014119_1099014132 12 Left 1099014119 12:77324927-77324949 CCGCGGGCTGCTAGGTGGCGGCG 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG 0: 1
1: 1
2: 2
3: 66
4: 531
1099014118_1099014132 13 Left 1099014118 12:77324926-77324948 CCCGCGGGCTGCTAGGTGGCGGC 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG 0: 1
1: 1
2: 2
3: 66
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099014132 Original CRISPR GAGGCGCGGCCCGGCGGAGG AGG Intergenic
900123941 1:1061376-1061398 GAGGCAGGGCCCGAAGGAGGAGG + Intergenic
900418915 1:2547178-2547200 GAAGCGCTGCCCGGCTGGGGAGG - Intergenic
900468167 1:2835844-2835866 GAGGGGCAGCCTGGCCGAGGGGG - Intergenic
900534608 1:3170684-3170706 GAGGCGGGGCCCGGGGGAGCAGG + Intronic
900577985 1:3393848-3393870 GAGGCGGGGCGGGGCGGGGGCGG - Intronic
900604939 1:3519749-3519771 GAGGCCCGGCCCGGGAGGGGAGG - Intronic
900629239 1:3624991-3625013 GGGGCGCGGCCGGGTGGTGGCGG + Exonic
900948548 1:5844810-5844832 AAGGCGAGACCCGGGGGAGGCGG - Intergenic
901930954 1:12595841-12595863 GAGGAGGGGCTGGGCGGAGGGGG + Intronic
902726231 1:18337972-18337994 GAGGGGAGGGCCGGGGGAGGCGG + Intronic
902770117 1:18640901-18640923 GAGGGGGCTCCCGGCGGAGGGGG + Intronic
902911051 1:19597328-19597350 GAGTTGCAGCCCGGAGGAGGTGG + Intronic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
903652538 1:24930444-24930466 AAGGCGCCACCCCGCGGAGGAGG + Intronic
903822144 1:26111290-26111312 GAGGTGCGGCCCGACCAAGGAGG - Intronic
904181305 1:28668731-28668753 GAAGCCCGGCCTGGCGGCGGCGG + Intronic
904500203 1:30908792-30908814 TGGGGGCGGCCCGGCGGCGGCGG - Intergenic
904618066 1:31760593-31760615 GAGGGGCGGGCCGGGGGAAGGGG + Intronic
904642010 1:31938134-31938156 CCGGCCCGGCCCGGCGGCGGCGG + Exonic
905414221 1:37793785-37793807 GAGAGGCGGCGCGGCGGGGGCGG - Exonic
905440827 1:37995962-37995984 GAGGCCCGGCCCTGGGCAGGCGG - Intergenic
905617110 1:39408929-39408951 GGGGCGGGGCCCGGCGGGGGCGG - Intronic
905775664 1:40665712-40665734 GAGGCGGGGCCTGCCGGGGGCGG + Intergenic
906198804 1:43946627-43946649 AAGGCGGCGCCCTGCGGAGGAGG - Intergenic
906551344 1:46668469-46668491 GAGGCGGGGCGGGGAGGAGGGGG + Intronic
908124247 1:61014441-61014463 GAGGAGCTGCCCAGAGGAGGGGG - Intronic
912401606 1:109397941-109397963 GTGGCGCGCGCCGGCGGGGGTGG - Exonic
912429086 1:109619810-109619832 GAGGCGGGGCCAGGCGGGGGCGG + Intronic
913047955 1:115089551-115089573 GGGGCGGGGCCCGGCGGGGAGGG + Intergenic
914428561 1:147600068-147600090 GTGGCGCGGTGCGGCGGGGGAGG + Intronic
914753045 1:150548973-150548995 GCGGCGCGGCGCGGCACAGGCGG - Intergenic
915648928 1:157293620-157293642 GAGGCCTGGCCCAGAGGAGGGGG - Intergenic
916037334 1:160933375-160933397 GAGTGGCTGCCGGGCGGAGGGGG - Intergenic
916694336 1:167221136-167221158 TCGGAGCGGCCAGGCGGAGGGGG + Intronic
917583227 1:176397157-176397179 GATGGGCGGCCAGGCGGAGACGG + Intergenic
918064406 1:181089553-181089575 GAAGCGCTGCGCGGCGGGGGTGG + Exonic
919658906 1:200223972-200223994 GAGGAGTGGCCCCGCGTAGGGGG - Intergenic
920022681 1:202967337-202967359 GAGGCGGGGCCTGGCGGGGGGGG + Intergenic
920022716 1:202967418-202967440 GGGGCGGGGTCCGGCAGAGGCGG + Intergenic
920458296 1:206117299-206117321 GAGGCGCGGTCCGGGGCAGTCGG + Exonic
921172100 1:212558982-212559004 TGCGCGCGGCCCGGCGGGGGCGG + Intergenic
922648660 1:227318283-227318305 GGGAGGCGGCCCGGCGCAGGAGG + Exonic
922739383 1:228006913-228006935 GCGGCGCGGGGCGGCGGGGGCGG - Intergenic
922811153 1:228416415-228416437 GACGCGGCGGCCGGCGGAGGCGG + Intronic
924957677 1:248944959-248944981 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
924957682 1:248944988-248945010 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1063660963 10:8034898-8034920 GAGGCGCCGCCCGGCCGCGCTGG - Intergenic
1063995088 10:11611518-11611540 GCGGCGCGGCGCGGCGGCGGCGG + Intronic
1064418118 10:15168292-15168314 GAGGCGAGGCCCGGGGTGGGCGG - Intronic
1065520590 10:26567328-26567350 GGGGGGCGGCCTGGCGGAGTCGG - Exonic
1066460525 10:35608515-35608537 GGGGCGCGGCCAGGCGGCTGGGG - Exonic
1067071912 10:43138585-43138607 GAGTCGCGGACCGGCGGGCGAGG - Intronic
1067300279 10:45001251-45001273 GAGGCGCGGCCCGCGGCGGGTGG + Intronic
1067669628 10:48306989-48307011 GAGGCGGGGGCCAGCCGAGGGGG + Intronic
1070570783 10:77638175-77638197 CAGGGGCGCCCGGGCGGAGGGGG - Intronic
1070610167 10:77927092-77927114 GAGGGACGGGCCGGCGGCGGCGG - Intergenic
1072772495 10:98152999-98153021 GGGCGGCGGCCGGGCGGAGGCGG - Intronic
1073063409 10:100745296-100745318 GGGGAGCGGACCGGGGGAGGGGG - Intronic
1073147817 10:101292067-101292089 GAGGCGCTGCCCCGCGGGGGCGG - Intergenic
1075048619 10:119165667-119165689 CACGCGCGGCCTGGCGGCGGCGG - Exonic
1075536300 10:123275002-123275024 GATGAATGGCCCGGCGGAGGGGG + Intergenic
1075785819 10:125049443-125049465 GAGGCGCTGCCTGGGGGAGGTGG - Intronic
1076372284 10:129963560-129963582 GCGGCGCCGGCCGGCGGAGGGGG + Intronic
1076546880 10:131251299-131251321 GAGGAGGGGCCGGGGGGAGGGGG - Intronic
1076554270 10:131311775-131311797 GCGGCGCGGGCGGGAGGAGGAGG - Intergenic
1076603859 10:131676996-131677018 GGGGCGGGGCCGGGGGGAGGGGG - Intergenic
1076683525 10:132186892-132186914 GGGGCGGGGCCCAGCGGGGGCGG + Exonic
1076858216 10:133127779-133127801 TGGGCGGGGCCAGGCGGAGGTGG - Intronic
1076858228 10:133127809-133127831 TGGGCGGGGCCAGGCGGAGGTGG - Intronic
1076858240 10:133127839-133127861 TGGGCGGGGCCAGGCGGAGGTGG - Intronic
1076858252 10:133127869-133127891 TGGGCGGGGCCAGGCGGAGGTGG - Intronic
1076991746 11:279320-279342 GAGGCGCGGCCCCGTGCTGGAGG - Exonic
1077038592 11:507337-507359 GGGGCGGGGCCCGGCGGGCGGGG + Intergenic
1077372076 11:2187051-2187073 GAGGCACGGCCGGGCGAAGGGGG + Intergenic
1077491496 11:2862906-2862928 GACGCGCGGCGCGGTGGGGGCGG + Intergenic
1077495276 11:2884210-2884232 GGGGCGCGGGCCGGCCGGGGTGG + Intronic
1078594414 11:12674459-12674481 GAGGCTCGGCTCGGCTCAGGCGG - Intergenic
1080015911 11:27506686-27506708 CAGCCGAGGCTCGGCGGAGGTGG - Intronic
1080802210 11:35619008-35619030 GAGCCGCGGCCTGGAGGAGCAGG + Exonic
1081699973 11:45146804-45146826 GGCGGGCGGCTCGGCGGAGGCGG - Intronic
1081740089 11:45433045-45433067 GAGGCGCGGCCTGGGGCTGGAGG + Intergenic
1081805020 11:45885770-45885792 GGAGCGCGGCGCGGAGGAGGCGG - Exonic
1082028690 11:47589842-47589864 GAGGCCCGGCGGGGCGGCGGGGG + Exonic
1083208292 11:61166577-61166599 GGGTCGCGGCCGGGCAGAGGCGG + Intergenic
1083571590 11:63764452-63764474 GAGGCCCGGGCCCGCAGAGGAGG - Exonic
1083583317 11:63839098-63839120 GAGCCGAGGGCCGGCGGTGGTGG + Exonic
1083658444 11:64241383-64241405 AAGGCGGAGCCCGGCGGCGGGGG + Intronic
1083726316 11:64630375-64630397 GCGGCGCGGGCCCGCGGAGGAGG - Intronic
1084070071 11:66728170-66728192 GAGCCGCGGCCGGGCGGGCGGGG + Intronic
1084295840 11:68213137-68213159 GAGGAGCGGGGCGGCGCAGGCGG - Exonic
1084517098 11:69642985-69643007 GCGGCGCGACCTGGCGGCGGCGG + Intronic
1084839292 11:71831643-71831665 GGGCGGCGGCCGGGCGGAGGCGG - Intergenic
1084944817 11:72632821-72632843 GAGGCACTGCCCGGAGGTGGAGG + Intronic
1085332810 11:75667702-75667724 GAGGCGGCCCCCGGCGGAGCGGG - Exonic
1089249104 11:117144682-117144704 GAGGCGCCGGCCGGCGGCTGAGG - Intronic
1089507187 11:118971820-118971842 GAGGCGCGGCGGCGCGGAGTGGG - Exonic
1090990839 11:131815630-131815652 GAGGCGCGGGCAGCAGGAGGGGG - Intronic
1092045949 12:5431996-5432018 GCGGCGCGGGCCGGCGGGGGAGG + Intergenic
1092219123 12:6700759-6700781 GGGGCGCGGGGCGGCGGCGGTGG + Intronic
1092796040 12:12111047-12111069 GAGGAGGCGCGCGGCGGAGGCGG - Intronic
1094041108 12:26122614-26122636 GGGGGGCGGCGCGGCGGCGGCGG - Exonic
1095672410 12:44876363-44876385 GAGGGGCGGGCCGGGGGAGGCGG + Intronic
1096413136 12:51391464-51391486 GAGGCGAAGGCTGGCGGAGGAGG + Intronic
1096491368 12:52014912-52014934 AAGGCGCGGGCCGGGGGCGGCGG - Exonic
1097981517 12:65741644-65741666 GGGGCGGGGCCGGGCGGCGGGGG + Intergenic
1098161154 12:67649035-67649057 GAGGGGCGGCCGGGAGGCGGCGG + Exonic
1098255454 12:68611136-68611158 GAGGCGCGGGCCGGGCGCGGCGG + Intronic
1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101504169 12:105330951-105330973 GAGGCGGGGGCCGGCGGGGGCGG + Intronic
1103432961 12:120903900-120903922 GTGGCCGGGCCCGGCGGCGGCGG + Exonic
1103488073 12:121296372-121296394 AGGGCGCGGCCCAGCCGAGGAGG + Intronic
1104568395 12:129904309-129904331 GTGGGGCGGCCAGGGGGAGGTGG - Intergenic
1104591616 12:130088484-130088506 GAGGCGGGGCCGGTGGGAGGCGG + Intergenic
1104854314 12:131894916-131894938 GAGGCGCGGGCCGGGGCGGGCGG - Exonic
1104982086 12:132577630-132577652 GAGGGGTGACCCGGGGGAGGGGG - Intronic
1105022999 12:132829383-132829405 GAAGAGCGGCCTGGCGGATGAGG - Intronic
1105388987 13:19958501-19958523 GAGTCGAGGGCCGGCGGAGGCGG + Intergenic
1105514323 13:21076471-21076493 GAGGGGAGGCCCGGGGGTGGGGG + Intergenic
1106517161 13:30465389-30465411 CCGGCGCGGCTCGGCGGCGGCGG - Intronic
1107844904 13:44501552-44501574 GAGGCTAGGCCGGGTGGAGGGGG + Intronic
1110965484 13:81689952-81689974 GAGGAGGCGCGCGGCGGAGGCGG - Intergenic
1113779713 13:112969153-112969175 GGGGGGCGGCTCGGCGGAAGCGG - Intronic
1113813076 13:113154027-113154049 GAGGCGGGGCGTGGAGGAGGCGG + Intergenic
1113813134 13:113154148-113154170 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813142 13:113154164-113154186 GAGGCGGGGCGCGGGGGAGGAGG + Intergenic
1113813210 13:113154304-113154326 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813218 13:113154320-113154342 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813226 13:113154336-113154358 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813234 13:113154352-113154374 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813242 13:113154368-113154390 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813250 13:113154384-113154406 GAGGCGGGGCGCGGGGGAGGAGG + Intergenic
1113908303 13:113830461-113830483 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908331 13:113830536-113830558 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908359 13:113830611-113830633 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908387 13:113830686-113830708 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908414 13:113830762-113830784 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113989951 13:114353294-114353316 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989956 13:114353323-114353345 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989961 13:114353352-114353374 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989966 13:114353381-114353403 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1116835666 14:49767609-49767631 GAGGCGGCGCCCGGCAGGGGCGG + Exonic
1116835817 14:49768262-49768284 CAGGCGTGCCCCGGCGGCGGCGG + Exonic
1117029069 14:51651345-51651367 AAGGCGGTCCCCGGCGGAGGTGG - Intronic
1117251906 14:53947005-53947027 GTGGCGCTGCCCGGCGGCGAGGG + Intergenic
1117315354 14:54566833-54566855 GCGGCGCGGCGCGGGGGAGCCGG + Intergenic
1118314488 14:64717283-64717305 GAGGCGAGGCCTGAGGGAGGGGG + Intronic
1119418699 14:74493512-74493534 GAGGCGGGGCGGGGCGGAGGTGG - Exonic
1119480576 14:74955453-74955475 GGGGAGCGGCCCGGCGGGGCGGG + Exonic
1119759236 14:77139812-77139834 GACGCGCGGCACGGAGGAGCGGG - Intronic
1120993380 14:90397627-90397649 GAGGGGCGGGCCGGGGGGGGGGG - Intronic
1121052450 14:90828315-90828337 GGGGCGAGGCGGGGCGGAGGCGG + Intergenic
1121109593 14:91303420-91303442 GAGGCGGGGTCTGGGGGAGGTGG - Intronic
1121183610 14:91947777-91947799 GCAGCGCGGCCCGGCGGGGAGGG + Exonic
1121710999 14:96039282-96039304 GGGGCGGGGCTCGGCGGACGGGG - Intergenic
1122159595 14:99773728-99773750 GAGGAGCAGCCAGGCCGAGGTGG + Intronic
1122183503 14:99972001-99972023 CAGGGGCGACCCGGCGGCGGCGG - Intronic
1122231102 14:100306615-100306637 GAGGCGGGGCGCGGGGGACGTGG + Intergenic
1122271063 14:100568644-100568666 GAGGGGCTGCCCGGCTGAGCGGG - Intronic
1122347074 14:101067354-101067376 GAGGAGCGGTCCCGAGGAGGAGG - Intergenic
1122550220 14:102545270-102545292 GAGACGAGGCCCAGAGGAGGCGG - Intergenic
1122635397 14:103127339-103127361 GCGGCGCGGCGTGGCGGAGGCGG + Exonic
1122768146 14:104085501-104085523 GAGGCGGGGCCTGGCGGGGTGGG - Intergenic
1122917322 14:104865188-104865210 GCGGCGCGGCCGGGCGGGGGCGG + Intergenic
1122917541 14:104865832-104865854 GCGGCCGGGCCCGGCGGGGGAGG - Intronic
1122975182 14:105168137-105168159 GAGGCGCGGGCCGGGGTCGGCGG + Intronic
1123055658 14:105568508-105568530 GAGGCTCAGCCCTGCGGGGGAGG - Intergenic
1123080017 14:105688027-105688049 GAGGCTCAGCCCTGCGGGGGAGG - Intergenic
1123630803 15:22258324-22258346 GGGGCGCGGCGCGGCGCGGGCGG + Intergenic
1123964093 15:25438552-25438574 GAGGCGGTGGCGGGCGGAGGCGG - Exonic
1124370756 15:29103595-29103617 GAGGCGCAGCCCCGCGGAGCCGG + Intronic
1124453845 15:29822496-29822518 CATGCCCGGCCCGGCGGGGGCGG + Exonic
1124500454 15:30223315-30223337 GGGGCCGGGGCCGGCGGAGGAGG + Intergenic
1124652326 15:31483271-31483293 GCGGCGCGGCGCGGCGCGGGCGG - Exonic
1124743120 15:32315352-32315374 GGGGCCGGGGCCGGCGGAGGAGG - Intergenic
1126109418 15:45166955-45166977 AAGCCGCGCGCCGGCGGAGGCGG - Intergenic
1126668180 15:51093731-51093753 GCGGAGCGGACCGGTGGAGGTGG + Intronic
1128109621 15:65068138-65068160 GAGGCCCAGCCCGGCGGTGGGGG - Intronic
1128161037 15:65422956-65422978 GAGGCGCGGCGCCGCGGGCGGGG + Exonic
1128315055 15:66654964-66654986 GAGGGGCGGGCCGCGGGAGGGGG - Intronic
1128374465 15:67065513-67065535 GTGGCGGGGCGCGGGGGAGGAGG + Intronic
1129260771 15:74365994-74366016 GGCGCTCGGCCCCGCGGAGGCGG - Intronic
1129274062 15:74433890-74433912 GCGGCACGTCCGGGCGGAGGAGG + Exonic
1130015550 15:80183399-80183421 GAGGAGCGGGCAGGTGGAGGTGG + Intronic
1130139177 15:81209282-81209304 GAGGGGCGTCCTGGGGGAGGTGG + Intronic
1130141398 15:81229286-81229308 GAGGGGCGTCCTGGGGGAGGTGG + Intronic
1130370907 15:83284645-83284667 GGGGCGCGACCCGGCGAAGTGGG + Exonic
1131475385 15:92734218-92734240 GGCGCGCGGCGGGGCGGAGGCGG - Intronic
1132398187 15:101489415-101489437 GCTGGGCGGCCCGGCCGAGGCGG - Exonic
1132641969 16:982078-982100 CCGGGGCGACCCGGCGGAGGCGG + Exonic
1132847994 16:2009488-2009510 GGGGCGCGGCCCGGGGGCAGCGG - Intronic
1132889445 16:2196633-2196655 GGGGGGCGGCCCGGGGGCGGGGG + Intergenic
1133121579 16:3611750-3611772 GAGGCGGGGCGAGGCGGAAGCGG + Intronic
1133270539 16:4609076-4609098 GAGGCAGGGCCCTGGGGAGGGGG + Exonic
1133271891 16:4614440-4614462 GACTCGCGGCCCCGCGGGGGCGG + Intronic
1133771275 16:8868500-8868522 GCGGCCAGGCCCGGCGGGGGAGG - Intronic
1134005972 16:10818987-10819009 CAGGCCCGGCCCGGGGGATGTGG + Intergenic
1134006027 16:10819152-10819174 CAGGCCCGGCCCGGGGGATGTGG - Intergenic
1134134189 16:11668671-11668693 GAGGGGCGGCCCGGCGGGCGCGG + Intronic
1134135592 16:11674559-11674581 GTGGCTCGGCCAGGTGGAGGTGG + Intronic
1135821744 16:25691952-25691974 GAGGCGCGGAGGGGAGGAGGAGG - Intergenic
1135976113 16:27109841-27109863 GATGCGCGGCACTGCAGAGGCGG + Intergenic
1138360581 16:56424886-56424908 GAGGCGCGGGGAGGGGGAGGGGG - Intronic
1138507731 16:57486503-57486525 GCGGCGAGACCTGGCGGAGGGGG - Intronic
1139484342 16:67247525-67247547 GGGGCGGGGCCAGACGGAGGCGG + Exonic
1139784957 16:69385568-69385590 GAGGGCCGGGCCGGGGGAGGGGG - Intronic
1140033849 16:71358606-71358628 GGGGCGCGGCGCGGCGGGGGCGG - Intergenic
1140875861 16:79152190-79152212 GAGGCGAGGCCCTGAGGAGCGGG + Intronic
1140891289 16:79287385-79287407 GAGGCGGGGGCTGGCGGGGGAGG + Intergenic
1141132241 16:81444603-81444625 GAGGCGCGGCCCGACGGGAGGGG - Intergenic
1141531229 16:84648448-84648470 GAGGCGGGGCCGGGCGGCGCGGG - Intergenic
1141694796 16:85614192-85614214 GAGGCGCATCCAGGCGGAGCAGG - Intronic
1142120351 16:88383698-88383720 GGCGGGCGGCCCGGAGGAGGCGG - Intergenic
1142156306 16:88534227-88534249 GGGGCGTGGCCGGGCGGCGGGGG - Exonic
1142586957 17:979810-979832 GTGGCGCGGGCAGGCGGAGGGGG - Intergenic
1143608243 17:8003128-8003150 GGGGCAGGGCCCGGGGGAGGCGG - Exonic
1143731532 17:8885320-8885342 GAGGCAGGGCCCTGGGGAGGCGG - Intronic
1143731571 17:8885418-8885440 GAGGCGAGGCCATGGGGAGGCGG - Intronic
1143731600 17:8885484-8885506 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143731669 17:8885648-8885670 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143731751 17:8885829-8885851 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143747149 17:9003167-9003189 GAGTCGCGGCCGGGTGGGGGCGG + Intergenic
1144816512 17:18039248-18039270 GAGGCGCGGCGTGGAGGGGGCGG - Intergenic
1146339654 17:32007827-32007849 GCGGGGCGGGCCGGCGGCGGTGG - Intergenic
1147307406 17:39573640-39573662 CCGGCGCGGCCCGGCGGCGGCGG - Intergenic
1147657366 17:42098488-42098510 GGGGCGGGGCCCGGCGGGGCAGG + Intergenic
1147719808 17:42532131-42532153 GACGCCCGGCCCGGCGGCGGCGG - Intergenic
1148060061 17:44830087-44830109 GGGCCGAGGCCCGGCGGAGGAGG - Intronic
1148081195 17:44968391-44968413 GGGGCGGGGCCCGGCCGAGGGGG - Intergenic
1148128078 17:45247066-45247088 GAGGCGGGCCACAGCGGAGGAGG - Exonic
1148323720 17:46771752-46771774 GCGGCGCGGCGCGGGGGCGGGGG - Intronic
1149430820 17:56594476-56594498 GAGGACCGGCCCGGCGGGGGCGG + Exonic
1149994490 17:61399607-61399629 CAGGCGCGGGCGGGCGGTGGGGG + Intergenic
1150217068 17:63476890-63476912 GAGGTGCAGCCCGGGGGTGGCGG - Intergenic
1150217117 17:63476994-63477016 GAAGCGCGGCGGGGCGGGGGCGG + Intergenic
1150250061 17:63700163-63700185 GGGGCGGGGGCCGGCGGGGGCGG - Intronic
1150643469 17:66964620-66964642 GAGGCGCGGGCCGAGGGGGGAGG + Intergenic
1151565086 17:74893286-74893308 GGGGCGGGGTGCGGCGGAGGTGG - Intronic
1151570636 17:74923763-74923785 GGAGCGCGGGCCGGCGGCGGGGG + Intergenic
1151660704 17:75516619-75516641 GCGGCGCGGCCCGGCCGGAGTGG + Intronic
1152245678 17:79183468-79183490 GAGGGGAGGCCCAGAGGAGGAGG - Intronic
1152581193 17:81166244-81166266 GCGGAGCGGCGCGGGGGAGGGGG + Intergenic
1152648564 17:81481585-81481607 GCGGGCCGGCCCGGGGGAGGGGG + Intergenic
1152781481 17:82229030-82229052 GCGGAGCGGACCGGCAGAGGCGG + Intronic
1152823778 17:82450732-82450754 GAGACGCGAACCGGCGGGGGCGG + Intronic
1152853053 17:82648728-82648750 GAGGCGGGGCGGGGAGGAGGGGG + Intergenic
1152853100 17:82648832-82648854 GAGGCGGGGCGGGGAGGAGGGGG + Intergenic
1153457312 18:5295547-5295569 GGGGAGCGGCCAGGCGGCGGCGG - Intronic
1153900641 18:9614572-9614594 GAGGGGCGGCGGGGAGGAGGAGG + Intronic
1155654585 18:28178033-28178055 GCGGGGAGGCTCGGCGGAGGAGG - Intergenic
1157464453 18:47931279-47931301 GGGGCGCGGCCGGGCGGGGCGGG + Intergenic
1157529503 18:48409419-48409441 GAGGCGCGGCGCGGGGAGGGAGG - Intronic
1157588927 18:48824478-48824500 GAGGCACGGAGAGGCGGAGGAGG - Intronic
1158954383 18:62524450-62524472 GAGCCCCAGCCCGGCGCAGGTGG + Intronic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1160453333 18:78979735-78979757 GAGGGGCCGCCCGGCGGCGGCGG + Intergenic
1160453597 18:78980676-78980698 GGGGGGCGGCGCGGCGGCGGAGG - Intronic
1160557897 18:79738002-79738024 GAGGCGGGGACCTGCGGGGGAGG - Intronic
1160613845 18:80109361-80109383 GAGGCGCGGGCGGGCGCAGGCGG + Exonic
1160690245 19:458217-458239 GACGCGGGTTCCGGCGGAGGGGG + Intronic
1160719303 19:590353-590375 GGGGCCGGGGCCGGCGGAGGAGG + Exonic
1160788313 19:912080-912102 GGGGCGCGGCCCCGGGGAGGTGG + Intronic
1160788385 19:912228-912250 GGGGCGCGGCCCCGGGGAGGTGG + Intronic
1160823023 19:1067116-1067138 GGGGCGCGGCCCGGGGCTGGGGG + Intronic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160913100 19:1483813-1483835 GCGGCGGGGCCGGGCGGGGGCGG - Intronic
1160920133 19:1515643-1515665 GACGCGGGTCCCGGCGGATGTGG + Intergenic
1160966572 19:1749383-1749405 GAGGCGCGGCCAGGGCGATGCGG + Intergenic
1161088570 19:2346198-2346220 GGGGCGTGGCTCGGCAGAGGAGG - Intronic
1161089320 19:2352260-2352282 GAGGCGCTGCCCGGAGGGGCGGG - Intronic
1161264614 19:3358646-3358668 GAGGAGGGGCCGGGCCGAGGTGG - Intergenic
1161664667 19:5568058-5568080 CAGGCCCGGCCCGGCGGGGCGGG + Intergenic
1161808757 19:6459646-6459668 GAGGGGAGGCCCGGCAGCGGCGG + Exonic
1161856271 19:6767556-6767578 GAGGCGGGGCCCGCAGGGGGCGG - Exonic
1162067723 19:8136363-8136385 GAGCCGCGGCCAGGTGGAAGGGG - Intronic
1162494971 19:11018454-11018476 GAGGCGGGGCCTGGCTCAGGTGG - Intronic
1162575845 19:11498266-11498288 GAGGCTCAGCCTGGGGGAGGTGG - Intronic
1162932038 19:13962255-13962277 GAGCCCCGGGCCGGCGCAGGTGG - Exonic
1162975783 19:14206503-14206525 GCGGCGCCGCCGGGCGGCGGGGG - Intergenic
1163085990 19:14979909-14979931 GAGGCGCGGCTCCGAGCAGGGGG - Intronic
1163282105 19:16324581-16324603 GGGGCGGGGCCCGGGAGAGGGGG + Intergenic
1163390482 19:17027193-17027215 GAGGGGCGGGCCCGGGGAGGGGG - Intergenic
1163655573 19:18543304-18543326 GGGGCGCGGCCGGGCGGGGGTGG - Intronic
1163851124 19:19664079-19664101 GAGGCGGGGCCCGGTGCGGGGGG + Intergenic
1163986091 19:20952662-20952684 GGGCGGCGGCCAGGCGGAGGCGG + Intergenic
1164986723 19:32653718-32653740 GAGGCGTGGCGTGGCGGGGGCGG + Intronic
1165204521 19:34172457-34172479 AAGCCGCGGCGCGGCGGCGGCGG - Intergenic
1165331016 19:35141268-35141290 GAGGCGGGGCCAGGGAGAGGCGG - Intronic
1166064315 19:40348299-40348321 GAGGCGCGGGCCGGGGGTGGTGG - Intronic
1166144645 19:40825871-40825893 GAGGTGGGGCAGGGCGGAGGGGG - Intronic
1166796402 19:45428808-45428830 GACGCGCGGCCCGGCGATCGCGG + Intronic
1167258113 19:48443039-48443061 GAGTGGCGGCCCGACGGCGGTGG - Exonic
1167788470 19:51655469-51655491 CAGACGCGGGCCGGGGGAGGGGG - Intergenic
1168280195 19:55301666-55301688 GAGGGGGGGACCGGCGGAGGGGG + Intronic
1168346431 19:55652302-55652324 GAGGCACGGGCCGGTGCAGGTGG - Intronic
1202711324 1_KI270714v1_random:20826-20848 GAGGGGTGGCCAGGCGGAGAGGG - Intergenic
926013058 2:9423497-9423519 GAGGCGCGGCCCGGCGGACGTGG - Intronic
926130915 2:10302770-10302792 GGGGCGGGGCCCGGAGGGGGCGG + Intergenic
926130936 2:10302842-10302864 GAGGCGGGACCCGGAGGCGGGGG - Intergenic
926202671 2:10812809-10812831 GAGGGGCGGCCGCGCGGGGGCGG + Intronic
926296359 2:11571946-11571968 GAGGCGCAGGCAGGCGGAGCAGG - Intronic
926718511 2:15942325-15942347 GTGGGGCAGCCCGGCCGAGGAGG + Exonic
927714059 2:25341467-25341489 GCGGCGCAGGCCGGCGGTGGAGG + Intronic
927881442 2:26692659-26692681 GGCGCGGGGCCGGGCGGAGGAGG + Intergenic
927881496 2:26692826-26692848 GAGGCGCGGGCCGGGGGCGCCGG + Exonic
927988333 2:27429021-27429043 GAGGCGGGGCCCGGCGGGTGGGG + Intronic
928093973 2:28392970-28392992 GAGGCGCGGCCGGGCGAGGCGGG + Exonic
928278310 2:29921641-29921663 GGGGCGGGGCCCGGAGGGGGCGG + Intergenic
928511775 2:32010094-32010116 GCGGCCCGGCCCCGCGGCGGCGG - Intronic
929133504 2:38602166-38602188 GGGTCGCGGCGCGGCGGCGGCGG - Intronic
929189289 2:39124400-39124422 GAGGCGCGTCCGGGCGGAATAGG + Intergenic
930136228 2:47906057-47906079 GAGGCGAAGCGCGGCGGCGGCGG + Intergenic
931274897 2:60735828-60735850 GAGGCGCGTCCCGGCTCCGGCGG + Intergenic
931429236 2:62196200-62196222 GACGGGCGGCCCGGCGGTGTCGG - Exonic
931727976 2:65129704-65129726 GAGGGGCGGCCGCGCGGGGGAGG - Intronic
932699907 2:73985217-73985239 GGGGCCCGGCCCGGGGGAGGGGG + Intergenic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
935396830 2:102619103-102619125 GAAGCCCGGGCCGGTGGAGGAGG - Intergenic
936388791 2:112054581-112054603 GAGGCGGGGCCGCGTGGAGGCGG - Intergenic
936388797 2:112054597-112054619 GAGGCGGGGCCGCGTGGAGGCGG - Intergenic
936388841 2:112054729-112054751 GAGGCGGGGCCGCGTGGAGGCGG - Intergenic
936388873 2:112054829-112054851 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388879 2:112054845-112054867 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388885 2:112054861-112054883 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388891 2:112054877-112054899 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388897 2:112054893-112054915 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388903 2:112054909-112054931 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388909 2:112054925-112054947 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388915 2:112054941-112054963 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388921 2:112054957-112054979 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
936388927 2:112054973-112054995 GAGGCGGGGCCGTGTGGAGGCGG - Intergenic
938014749 2:127858094-127858116 GCGGCGCGGCGCGGCGATGGCGG - Exonic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
938727401 2:134120531-134120553 GAGGGGCTGCCCGGGGCAGGTGG - Intronic
942453307 2:176121974-176121996 GAGCCGGGGCGCGGCGGTGGAGG - Intergenic
945699538 2:213152265-213152287 GAGCCGCGTCCCGGCCGAGTCGG + Intronic
946836297 2:223776095-223776117 GAGGAGAGGCTCGGCGGGGGAGG - Intronic
947536611 2:230943644-230943666 GAGGCGGGGCCTGGTGGAGGGGG + Intronic
947641158 2:231708591-231708613 GAGGAGGCGCGCGGCGGAGGCGG - Exonic
947739552 2:232478909-232478931 CATGCGTGGCCCTGCGGAGGAGG - Intergenic
947800797 2:232927766-232927788 GCGGCGGGGGCCCGCGGAGGAGG + Intronic
947800942 2:232928229-232928251 GGGGCGAGGCCGGGCGGCGGCGG + Intronic
947827188 2:233114422-233114444 GAGGCCAGGCCGGGAGGAGGTGG + Intronic
948116034 2:235494631-235494653 GGGGCGCGGGGCGGCGGCGGCGG + Exonic
948205070 2:236159291-236159313 GAGGCCCGGCCAGGCTGGGGTGG + Intergenic
948368939 2:237475333-237475355 GAGGCGGGGCCGGGCCGCGGGGG + Intergenic
948473722 2:238203415-238203437 GAGGCCCGGGGCGGCTGAGGCGG - Intronic
948479516 2:238240839-238240861 GAGGCGGGGCGCGGAGGACGAGG - Intergenic
948801377 2:240435135-240435157 GAGGCGCGGCCGGCGGGCGGAGG + Intergenic
948824225 2:240566623-240566645 GAGGCGCGGCTGAGCCGAGGGGG - Intronic
1168847986 20:958562-958584 GTGGCCTGGCCAGGCGGAGGAGG + Exonic
1169867713 20:10218746-10218768 GGGGCGGGGCACGGCGGGGGCGG - Intergenic
1171567691 20:26209403-26209425 GAGGCGCCGACCGGAGGAGGGGG + Intergenic
1172013819 20:31861541-31861563 TGAGTGCGGCCCGGCGGAGGAGG + Exonic
1172037305 20:32019113-32019135 GAGGCCCGGGCCGGGGGAGGCGG + Exonic
1172100896 20:32483578-32483600 GCGCCGCGGCCCGGAGGAAGGGG + Intronic
1172474497 20:35226787-35226809 GGGGCCTGGCCCGGCGGCGGCGG - Exonic
1172702894 20:36863593-36863615 GGGGCGCGGCGAGGCCGAGGGGG - Exonic
1172979034 20:38927100-38927122 GAGGAGCGGCCCGGGGGATCCGG - Intronic
1173656399 20:44703093-44703115 GAAGCCCAGCCAGGCGGAGGGGG - Intergenic
1173821161 20:46021649-46021671 GGGGGGCGGGCGGGCGGAGGGGG + Intergenic
1174386623 20:50191356-50191378 GTGGTGCTGCCCGGAGGAGGCGG - Exonic
1174806698 20:53609803-53609825 GAAGCGTGGCCCGGAGGGGGAGG - Intronic
1175399672 20:58693140-58693162 TGGGCCCGGCCCGGCGGCGGCGG - Intronic
1175429529 20:58891686-58891708 GGGGCGCGGCCGGGCTGCGGCGG - Intronic
1175927039 20:62476045-62476067 AAGGGGCGGCGCGGCGGGGGCGG - Intergenic
1176054298 20:63135589-63135611 GAGGCGGGGCCCAGAGGGGGCGG + Intergenic
1176178820 20:63740325-63740347 GAGGCGGTGGCCGGGGGAGGGGG - Intronic
1176258159 20:64164470-64164492 GTGGCACGGGCTGGCGGAGGAGG - Exonic
1176421285 21:6518146-6518168 GAGGTGGGGCCTGGTGGAGGTGG + Intergenic
1176549011 21:8213562-8213584 GCGGCGCGGCGCGGCCGAGCCGG - Intergenic
1176556824 21:8257543-8257565 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1176575763 21:8440584-8440606 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1177010926 21:15729902-15729924 GAGGAGCCGCCGGGCGGGGGCGG + Intergenic
1178414532 21:32393097-32393119 GAGGCTGGGACCGGCGGAAGGGG + Intergenic
1178914394 21:36698749-36698771 CAGGCGCGGCCGAGAGGAGGCGG - Intergenic
1179696775 21:43126461-43126483 GAGGTGGGGCCTGGTGGAGGTGG + Intergenic
1180176448 21:46092736-46092758 TAGGCCCGGCCTGGAGGAGGAGG - Intergenic
1180264139 21:46698846-46698868 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264144 21:46698875-46698897 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264149 21:46698904-46698926 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264154 21:46698933-46698955 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264164 21:46698991-46699013 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264169 21:46699020-46699042 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264174 21:46699049-46699071 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264179 21:46699078-46699100 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264184 21:46699107-46699129 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264189 21:46699136-46699158 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264194 21:46699165-46699187 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264199 21:46699194-46699216 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264204 21:46699223-46699245 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264209 21:46699252-46699274 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264214 21:46699281-46699303 GAGGCGCGGCGCGCCGGCGGAGG - Intergenic
1181299279 22:21867754-21867776 GCCGCGCGGGCCGGCGGAAGCGG + Intergenic
1181478214 22:23181300-23181322 GAGGCCCGGCCCGACGGCGAGGG + Exonic
1181671531 22:24427696-24427718 GGGGTGCGGCCCCTCGGAGGAGG + Intronic
1182511346 22:30822525-30822547 GGTGGGCCGCCCGGCGGAGGCGG - Intronic
1182697703 22:32207567-32207589 GAGGCGCAGCCTGGGGAAGGAGG + Intergenic
1183355739 22:37358392-37358414 GAGGCTCGCCCCGGCGGACCTGG - Intergenic
1183370128 22:37427490-37427512 GAGGCGCGGCGGCGGGGAGGAGG - Intergenic
1183577353 22:38700608-38700630 TGGCCGCGGCCCTGCGGAGGAGG + Exonic
1183590598 22:38777321-38777343 GAGGCGGGGGCCGGCGCTGGAGG - Intronic
1184136615 22:42553757-42553779 GGGGCGCGGCCTGGCGGTGGGGG + Intronic
1184668177 22:45999413-45999435 GAGAGGCTGCCCGGAGGAGGTGG - Intergenic
1185269521 22:49922710-49922732 GAGGAGCGGCCCGGGGGTGGAGG + Intronic
1185313911 22:50170657-50170679 GGGGCGGGGCCCGGCGAGGGGGG - Intergenic
1185330272 22:50249209-50249231 GGGGAGGGGCCCGGGGGAGGGGG + Intronic
1185388405 22:50546920-50546942 GAGGCCGGGGCCGGCGGCGGCGG + Intergenic
1185409606 22:50674826-50674848 GGGGAGGGTCCCGGCGGAGGCGG - Intergenic
1185417951 22:50720354-50720376 TAGGCGCGGCCCGGCGGGGGCGG - Intergenic
1185430377 22:50807227-50807249 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1203253814 22_KI270733v1_random:129638-129660 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1203261870 22_KI270733v1_random:174717-174739 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
949522339 3:4868587-4868609 GAGGCGGGGCACGGAGGGGGCGG - Intronic
949565711 3:5243020-5243042 GATGGGCGGCCAGGCAGAGGTGG + Intergenic
950198443 3:11026142-11026164 GAGGGGTGGCCCGGAGGAGGGGG - Intronic
950710569 3:14810623-14810645 GGGGCGCGGGGCGGGGGAGGAGG - Intergenic
951543626 3:23806111-23806133 GCGGCGCGGCCGGGGGGCGGCGG - Intronic
952580224 3:34824368-34824390 GAGGAGCAAACCGGCGGAGGAGG + Intergenic
953657037 3:44862163-44862185 GGGGCGCCGCTGGGCGGAGGAGG + Intronic
954795862 3:53161144-53161166 GGGGCGGGGCCTGGCGGGGGCGG + Exonic
954838928 3:53494622-53494644 GCGGCGCGGCGCGGCGGGCGCGG + Intergenic
954882732 3:53846516-53846538 AAGGGGCGGCCCGGCGGCGCCGG + Intergenic
960914392 3:122681286-122681308 ATGGCGCGGCCCGGAGGTGGCGG + Intronic
961340348 3:126213179-126213201 AAGGCGCCGCCCGGCGGCCGCGG + Intergenic
961512055 3:127409236-127409258 GAGGGGAGGCCGGGAGGAGGAGG - Intergenic
961519972 3:127461429-127461451 GAGGCACGGCCCTGTGCAGGAGG + Intergenic
961603042 3:128075686-128075708 GAGGGGCAGCGCGGCGGGGGCGG + Intronic
961788722 3:129362569-129362591 TAGGGGCGGCCGGGCAGAGGCGG + Intergenic
961788773 3:129362696-129362718 TAGGGGCGGCCGGGCAGAGGCGG + Intergenic
961788874 3:129362946-129362968 TAGGGGCGGCCGGGCAGAGGCGG + Intergenic
961789051 3:129363347-129363369 TAGGGGCGGCCGGGCAGAGGCGG + Intergenic
961810662 3:129519804-129519826 GAGGCGTGGCCCCTGGGAGGAGG + Intronic
963133159 3:141876718-141876740 GAGGCGCGTCCCGGCTCCGGCGG - Exonic
966182355 3:177198000-177198022 GGGGGGCGGCCCGGCGGCGTTGG + Intergenic
966592182 3:181695578-181695600 GAGGCGCGGGCCGGCGGGCTGGG - Intergenic
966743393 3:183254069-183254091 GAGGCGCGGCGGGGCGGGGGCGG - Intronic
966919905 3:184604505-184604527 GGGGCGCGTCCCGGCGGGGCCGG + Intronic
967915596 3:194576067-194576089 GAGGAGAGGCCAGGAGGAGGCGG - Intergenic
968235811 3:197029587-197029609 GCGCCGCGGCCCGGCTGAGCAGG - Intronic
968434201 4:576428-576450 GAGGGGCGTCCCGGGGGTGGCGG - Intergenic
968583017 4:1403623-1403645 GAGGCGCGGGGAGGCGGCGGCGG - Exonic
968701323 4:2059463-2059485 GGGACGCGGCCGGGCGGCGGCGG - Intergenic
969134544 4:5019644-5019666 GAGGGGCTGCCTGGAGGAGGGGG + Intergenic
969239294 4:5888509-5888531 GAGGCGAGGGCGGGAGGAGGGGG + Intronic
969460588 4:7326813-7326835 GAAGCGCTGCCGGCCGGAGGTGG + Intronic
970913292 4:21304375-21304397 GAGGCCCGGCGCGGAGGAGATGG + Intronic
971421990 4:26481884-26481906 GAGGCGGCGCTCTGCGGAGGCGG + Exonic
972290591 4:37686639-37686661 GAGGCGGGGCCAAGCTGAGGTGG - Intergenic
972325418 4:38010844-38010866 GAGTCCCTGCCCGGAGGAGGAGG - Intronic
972475691 4:39447122-39447144 GAGGCGCGGCAGGGCCGAGCTGG - Exonic
975632987 4:76420934-76420956 GGGGCGCGGCCCGGGAGACGAGG - Intronic
975801062 4:78059101-78059123 GAGCCGCGGCTGGGCGGCGGCGG + Intronic
977231116 4:94452147-94452169 TGGGCGCGGAGCGGCGGAGGTGG + Intronic
978174149 4:105708985-105709007 GAGGCGCGGCCAGGCAGGGAGGG - Exonic
978648405 4:110970614-110970636 GAGGAGCAGCCCAGCAGAGGTGG + Intergenic
978885314 4:113761292-113761314 GAAGCGAGGCCCGCAGGAGGAGG - Intronic
980043578 4:127965337-127965359 GAGGCGCGTGCCGAGGGAGGAGG - Exonic
980130111 4:128810225-128810247 GGGGCGGGGGCCGGAGGAGGAGG + Intronic
981920297 4:150078724-150078746 GAGGCGTGGCCGGGTGGAGGAGG + Intronic
981945833 4:150343036-150343058 GAGGCGTGGCCTGGAGGTGGGGG + Intronic
984952363 4:185017093-185017115 GAGGCCCGTCCTGGGGGAGGTGG + Intergenic
985129025 4:186723630-186723652 GGGGCGCGGGCCGGCGGGCGGGG - Intronic
985466744 4:190203771-190203793 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
985466749 4:190203800-190203822 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
985618436 5:938475-938497 GAGGCCCGGTCCAGAGGAGGTGG - Intergenic
985648201 5:1095046-1095068 GAGGCGGGGCCGGTAGGAGGTGG + Intronic
985648207 5:1095062-1095084 GAGGTGGGGCCCGTAGGAGGTGG + Intronic
985772743 5:1823466-1823488 GTGTTGCGGCCTGGCGGAGGTGG + Intergenic
986297114 5:6448800-6448822 GGGGCCGGGCCCGGCGGTGGCGG + Exonic
986813599 5:11384951-11384973 GCCGCGCGGCGCGGCGTAGGTGG + Exonic
987075729 5:14380271-14380293 GAGGCGGGGCGCGAAGGAGGAGG - Intronic
987075735 5:14380290-14380312 GAGGCGGGGCGCGAAGGAGGAGG - Intronic
987075741 5:14380309-14380331 GAGGCGGGGCGCGAAGGAGGAGG - Intronic
989368583 5:40681724-40681746 GAGGCGCGGCAAGGCTGGGGAGG - Exonic
991298186 5:65103091-65103113 GAGGCGGGGCGCGGCGGGGCGGG - Intergenic
991913916 5:71587469-71587491 GGCGCGCGGCCCGGCGGGAGAGG - Exonic
993727357 5:91383421-91383443 GCGGCGCGGCGCGGCGCGGGAGG - Intergenic
995106130 5:108380640-108380662 GAGGCGGGGGCCGGGGGTGGGGG + Intronic
997584099 5:135034456-135034478 GAGGCGCGGCGAGGCCGCGGGGG - Intronic
997704020 5:135930291-135930313 GAGGCGGGGCCAGGCGGGGCGGG + Intronic
999188810 5:149731504-149731526 GAGGGGCGGCCGGGCGGAACCGG + Intronic
1001381416 5:171308924-171308946 GCGGCCCGGCCCGGAGGAGCGGG + Intergenic
1001652952 5:173328318-173328340 GAGCCGCGGCCGCGAGGAGGAGG - Exonic
1001773374 5:174311864-174311886 GGGCTGCGGCCCGGCGGCGGCGG + Intergenic
1002180090 5:177426809-177426831 GCGGCGCGGCCCGGCGGGCCAGG + Intronic
1002277434 5:178113376-178113398 GAGGCGCCGCACGGCGGTGGCGG - Intergenic
1002485280 5:179530770-179530792 GAGGCGCGGGAAGCCGGAGGAGG - Intergenic
1002532721 5:179858322-179858344 GAGGCGCGGGGCGACGGAGAGGG + Intronic
1002645147 5:180649255-180649277 GAGGCGCGGCCCGGCCGCCCTGG + Intronic
1002697480 5:181100643-181100665 GCGCTGCTGCCCGGCGGAGGCGG + Intergenic
1004396341 6:15248820-15248842 CAGGCGCGGCGGGGCGGCGGGGG + Intronic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1006300979 6:33193382-33193404 GGGGCGGGGCCGGCCGGAGGAGG - Intergenic
1006472700 6:34237446-34237468 GCGGCGCGAGCCGGCGGCGGGGG + Intronic
1006472719 6:34237492-34237514 GCGGCGGGGCCCGGCGGCGCGGG + Intronic
1006535659 6:34696812-34696834 GAGGCGAGAGGCGGCGGAGGCGG - Exonic
1006614896 6:35319512-35319534 GAGGCCCGGGCCTGTGGAGGGGG - Exonic
1007327638 6:41073772-41073794 GAGGAGGGGCGCGGCGGAGCAGG - Intronic
1007902063 6:45422094-45422116 GCGGCGCGGCGCGGCGGTGGCGG + Intronic
1007902537 6:45423834-45423856 GAGGCGCGGGCCAGGGGACGGGG + Intronic
1010032829 6:71288616-71288638 GAGGCGCGGCCTGGGGCCGGTGG + Intergenic
1012551725 6:100469514-100469536 GGGGCGCCGCCCCGCTGAGGTGG + Intergenic
1013117741 6:107115372-107115394 GAGGGGCGGGCCGGGGGTGGGGG - Intergenic
1014724810 6:124962124-124962146 GACGCGCGGCCCGAGGGCGGTGG - Intergenic
1015492070 6:133837909-133837931 GAGGCGCAGACGGGCGGAGCTGG - Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1018727847 6:166627346-166627368 GTGGCGGGGCGGGGCGGAGGAGG - Intronic
1018757361 6:166862227-166862249 GAGGCTCGGACCGGCACAGGGGG + Exonic
1019104062 6:169654795-169654817 GAGGCGCGCTCAGGAGGAGGAGG + Intronic
1019198459 6:170295979-170296001 GAGCCGCGGCGCAGAGGAGGGGG - Intronic
1019279357 7:192415-192437 GGGGCGCGGCCGAGGGGAGGAGG + Intergenic
1019342890 7:516953-516975 GACGGGCGGGCGGGCGGAGGCGG - Intronic
1019421738 7:954113-954135 GACACGCAGCCCGGCGGGGGAGG + Intronic
1019577755 7:1745744-1745766 GTGGCGCAGCCCGGCGCTGGTGG - Exonic
1020831856 7:13103098-13103120 TAGGGGCGGCCGGGCAGAGGCGG - Intergenic
1022923193 7:35036980-35037002 GGGGCTCGGCGCGGCGGAAGCGG + Intronic
1023875829 7:44285813-44285835 GGGGGGAGGCGCGGCGGAGGGGG + Intronic
1023937118 7:44748418-44748440 GGGGCGGGCCCCGGCGGAGGAGG - Intergenic
1023937172 7:44748548-44748570 GGGGCGGGGCCGGGCGGCGGAGG - Intergenic
1023951268 7:44847988-44848010 GGCGCGCGGCCGAGCGGAGGCGG - Exonic
1024043857 7:45574550-45574572 GGGGCGCCGCGCGGCGGAGGCGG + Exonic
1026840413 7:73667720-73667742 GCGGCGCGGCGCGGCCGGGGCGG + Intergenic
1026909494 7:74083957-74083979 GGGGCGGGGCCCGGCGGGGCTGG - Exonic
1029414817 7:100436144-100436166 GGGGCGCGGCTCGGCAGCGGCGG - Exonic
1029547284 7:101217130-101217152 GAGGCCCGGCACGGCCGAGGGGG - Intronic
1032081796 7:128862832-128862854 GGGGCGCCGTACGGCGGAGGCGG + Intronic
1032525706 7:132577096-132577118 GAGGCGCGGGGCTGCGGCGGTGG + Exonic
1033159210 7:138981593-138981615 GGGGCTCGGCGCGGCAGAGGCGG + Intergenic
1033299935 7:140176664-140176686 GAGGCGCGGGCGGCCGGCGGCGG + Intronic
1034441155 7:151086689-151086711 CCGGGGCGGCGCGGCGGAGGCGG - Intronic
1034445930 7:151114517-151114539 GCGGCGCGGCGCGGGGGAGCCGG - Intronic
1034618150 7:152436202-152436224 GCCGCGGGGCCCGGCGGGGGCGG + Intergenic
1035153282 7:156892820-156892842 GAGGCGAGGCCCGGAGGTGAGGG + Intronic
1035512938 8:206280-206302 GAGGCGCGGCGCGCCGGCGCAGG + Intergenic
1035747714 8:1973995-1974017 GAGGCGCGGGTCGGAGGGGGCGG + Intronic
1036162971 8:6406461-6406483 GAGGCGCGGCGAGGCGGAATCGG + Intergenic
1038017623 8:23528896-23528918 GCGCCGCGGCCCCGGGGAGGTGG + Exonic
1038295928 8:26291295-26291317 CAGCCGCGGCCTGGCGCAGGCGG + Intergenic
1038644473 8:29350840-29350862 GAGGAGGGGCCCGGAGGGGGCGG - Intergenic
1040065441 8:43140801-43140823 GCGGCCGGGCCCCGCGGAGGCGG + Intronic
1043873878 8:85463931-85463953 CGGGGGCGGCCCGGGGGAGGGGG - Exonic
1044719879 8:95134356-95134378 GGGGCGGGGGCCGGCGGACGCGG + Intronic
1045254623 8:100509258-100509280 GAGGCCAGGCCCGGGGGAGAAGG + Intergenic
1047961815 8:130016571-130016593 GAGGCGCGGCGAGGAGGAAGAGG + Intronic
1048970964 8:139644810-139644832 GTGCCGGGGCCCAGCGGAGGTGG - Intronic
1049212039 8:141391433-141391455 GAGGCCCGCCCAGGCGAAGGCGG - Intergenic
1049405306 8:142449669-142449691 GAGGAGCGGAGCGGCGGCGGCGG + Exonic
1049541538 8:143211311-143211333 GAGGCGGGGCGTGGGGGAGGAGG + Intergenic
1049541550 8:143211348-143211370 GAGGCGGTGCACGGGGGAGGCGG + Intergenic
1049541697 8:143211692-143211714 GAGGCGGGGCGTGGGGGAGGCGG + Intergenic
1049595878 8:143483134-143483156 GAGGAGCGGCCGGGGGGAGGCGG + Intronic
1049664202 8:143835783-143835805 GCGGCGCGGCCTGGCGGAGGGGG - Intronic
1049682062 8:143923673-143923695 GCTGCGCGGCGAGGCGGAGGCGG - Exonic
1049716398 8:144095072-144095094 GAGTGGCGGCCGCGCGGAGGAGG + Exonic
1052048548 9:23821753-23821775 GCGGCGCGGCGCGGCGCGGGTGG - Intronic
1054731428 9:68705612-68705634 GAGGGGCGGGAGGGCGGAGGGGG - Intronic
1054847250 9:69810199-69810221 GAGGCTCGGCACTGGGGAGGAGG + Intergenic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1055945392 9:81688192-81688214 GAGGCGCGGCTGGGTGGTGGTGG - Intronic
1056102436 9:83312745-83312767 GGGGCGCAGGGCGGCGGAGGGGG - Intronic
1057592324 9:96383452-96383474 GAGGCGGGGCCCGGGGCCGGGGG - Intronic
1057600125 9:96450447-96450469 GAGGCGCGACGAGGCGGCGGCGG + Exonic
1057810877 9:98255754-98255776 GGGGCGTGGCCTGGCGGTGGAGG - Intergenic
1059208450 9:112487381-112487403 GCGGGGCGGCCCGGGGCAGGCGG - Intronic
1059375224 9:113876142-113876164 GAGGGGCGGCTCGGCGGCAGCGG + Intergenic
1059633943 9:116154356-116154378 CAGGCACCGCCCGGCGGCGGCGG - Exonic
1060629600 9:125143570-125143592 GAGGAGAGGCGCGGAGGAGGCGG - Intergenic
1060770167 9:126326792-126326814 GGGGCGCGGCCTGGCGGCGGCGG - Intergenic
1060979641 9:127785168-127785190 GTGGCGGGGACCGGGGGAGGCGG + Intergenic
1060979821 9:127785682-127785704 CCCGCGCAGCCCGGCGGAGGCGG + Intronic
1061207675 9:129174124-129174146 TGGGCGAGGCTCGGCGGAGGCGG - Intergenic
1061438195 9:130579802-130579824 GAGGCGGGGCCTGGCGGGCGGGG + Intronic
1061483633 9:130909258-130909280 GGGGCGAGGGGCGGCGGAGGGGG - Intronic
1061666142 9:132161985-132162007 GAGACGCGGGCCGGGGGAGGGGG - Exonic
1061777808 9:132977653-132977675 GAGGCGGGGGCCAGAGGAGGAGG + Intronic
1062134667 9:134918805-134918827 GAGGGGCGGCCCAGGGGTGGGGG + Intergenic
1062325995 9:136012783-136012805 GGGGCGCGGGCCGGGGGCGGCGG + Intronic
1062414267 9:136439836-136439858 CGGGCGCGGCCCCGCGGCGGCGG - Intergenic
1062620324 9:137417630-137417652 GAGGAACGGCCGAGCGGAGGAGG + Intronic
1203470214 Un_GL000220v1:112786-112808 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1203478035 Un_GL000220v1:156758-156780 GAGGGGCGGCGGGGAGGAGGAGG - Intergenic
1185452590 X:290774-290796 GAGGTGCGGCCGGGCTGAGGTGG + Exonic
1185452609 X:290836-290858 CAGGTGCGGCCGGGCTGAGGTGG + Intronic
1185452629 X:290898-290920 CAGGTGCGGCCGGGCTGAGGTGG + Intronic
1185452649 X:290960-290982 CAGGTGCGGCCGGGCTGAGGTGG + Intronic
1185621342 X:1452934-1452956 GGGGCGTGGCCTCGCGGAGGCGG - Intronic
1185750889 X:2609160-2609182 GAGGAGGGGGCGGGCGGAGGTGG - Intergenic
1186496450 X:10015543-10015565 GCGGGGCGGCCGGGCGGCGGCGG + Exonic
1186768057 X:12791455-12791477 GGGGCGCGCGGCGGCGGAGGAGG - Exonic
1187447682 X:19373173-19373195 GAGGAGGGGCCAGGAGGAGGAGG + Intronic
1187518183 X:19991031-19991053 GTCCCGCGGCCCGGCAGAGGTGG - Intergenic
1187888021 X:23907498-23907520 GAGCGGCTGCCGGGCGGAGGCGG - Intronic
1188242675 X:27809525-27809547 GGGGCGGGGGCCGGCGGCGGGGG - Intronic
1189358403 X:40328944-40328966 GAGGAGGGGCCCCACGGAGGTGG + Intergenic
1190137170 X:47807657-47807679 AAGGAGCAGCCCGGGGGAGGGGG + Intergenic
1190263720 X:48815488-48815510 GAGGTGAGCCCCGGTGGAGGAGG + Exonic
1194977718 X:100410373-100410395 GGGGCGGGGCCAAGCGGAGGCGG + Intergenic
1200100749 X:153688284-153688306 GGGGCCCGGCCGGGCGGCGGCGG - Exonic
1200128684 X:153829984-153830006 GAGGCGCGGTGCGGCGGGCGCGG - Intronic
1200155436 X:153972420-153972442 GAGGCGCGCCGCGGGGGAGCCGG + Exonic