ID: 1099014389

View in Genome Browser
Species Human (GRCh38)
Location 12:77326457-77326479
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099014389_1099014392 0 Left 1099014389 12:77326457-77326479 CCTAAGAAAACTGGAGAGCCAGG No data
Right 1099014392 12:77326480-77326502 CAGACCTTGCCAAAGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099014389 Original CRISPR CCTGGCTCTCCAGTTTTCTT AGG (reversed) Intergenic
No off target data available for this crispr