ID: 1099014913

View in Genome Browser
Species Human (GRCh38)
Location 12:77332813-77332835
Sequence TGAAGGAGCCACCTTGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099014909_1099014913 -6 Left 1099014909 12:77332796-77332818 CCAATTTACCAGTTGTATGAAGG No data
Right 1099014913 12:77332813-77332835 TGAAGGAGCCACCTTGGTAGAGG No data
1099014907_1099014913 10 Left 1099014907 12:77332780-77332802 CCCTCTGCTAATAGCTCCAATTT No data
Right 1099014913 12:77332813-77332835 TGAAGGAGCCACCTTGGTAGAGG No data
1099014908_1099014913 9 Left 1099014908 12:77332781-77332803 CCTCTGCTAATAGCTCCAATTTA No data
Right 1099014913 12:77332813-77332835 TGAAGGAGCCACCTTGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099014913 Original CRISPR TGAAGGAGCCACCTTGGTAG AGG Intergenic
No off target data available for this crispr