ID: 1099018924

View in Genome Browser
Species Human (GRCh38)
Location 12:77379489-77379511
Sequence CCTGCTAGGGTGAGGATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099018914_1099018924 30 Left 1099018914 12:77379436-77379458 CCTGTTACAGGTTTAGAGTCGTT No data
Right 1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG No data
1099018915_1099018924 7 Left 1099018915 12:77379459-77379481 CCATATATCAGAGTATAAAGTCA No data
Right 1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099018924 Original CRISPR CCTGCTAGGGTGAGGATGGG GGG Intergenic
No off target data available for this crispr