ID: 1099019410

View in Genome Browser
Species Human (GRCh38)
Location 12:77384787-77384809
Sequence GGTGCAGAAAACTCCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099019400_1099019410 28 Left 1099019400 12:77384736-77384758 CCATTTAAGTTTTTCTGGAAGAT No data
Right 1099019410 12:77384787-77384809 GGTGCAGAAAACTCCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099019410 Original CRISPR GGTGCAGAAAACTCCTCTGG AGG Intergenic
No off target data available for this crispr