ID: 1099019870

View in Genome Browser
Species Human (GRCh38)
Location 12:77390273-77390295
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099019870_1099019877 21 Left 1099019870 12:77390273-77390295 CCCTGGCTCCTCTCCATACACAG No data
Right 1099019877 12:77390317-77390339 CTGTTCGTGGGTATCTTGTTAGG No data
1099019870_1099019875 8 Left 1099019870 12:77390273-77390295 CCCTGGCTCCTCTCCATACACAG No data
Right 1099019875 12:77390304-77390326 AAATGATAGAACTCTGTTCGTGG No data
1099019870_1099019876 9 Left 1099019870 12:77390273-77390295 CCCTGGCTCCTCTCCATACACAG No data
Right 1099019876 12:77390305-77390327 AATGATAGAACTCTGTTCGTGGG No data
1099019870_1099019878 30 Left 1099019870 12:77390273-77390295 CCCTGGCTCCTCTCCATACACAG No data
Right 1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099019870 Original CRISPR CTGTGTATGGAGAGGAGCCA GGG (reversed) Intergenic
No off target data available for this crispr