ID: 1099019873

View in Genome Browser
Species Human (GRCh38)
Location 12:77390281-77390303
Sequence AACACCTACTGTGTATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099019873_1099019877 13 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019877 12:77390317-77390339 CTGTTCGTGGGTATCTTGTTAGG No data
1099019873_1099019875 0 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019875 12:77390304-77390326 AAATGATAGAACTCTGTTCGTGG No data
1099019873_1099019879 23 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019879 12:77390327-77390349 GTATCTTGTTAGGTGCTATTGGG No data
1099019873_1099019880 24 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019880 12:77390328-77390350 TATCTTGTTAGGTGCTATTGGGG No data
1099019873_1099019878 22 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG No data
1099019873_1099019876 1 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019876 12:77390305-77390327 AATGATAGAACTCTGTTCGTGGG No data
1099019873_1099019881 29 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019881 12:77390333-77390355 TGTTAGGTGCTATTGGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099019873 Original CRISPR AACACCTACTGTGTATGGAG AGG (reversed) Intergenic
No off target data available for this crispr