ID: 1099019878

View in Genome Browser
Species Human (GRCh38)
Location 12:77390326-77390348
Sequence GGTATCTTGTTAGGTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099019871_1099019878 29 Left 1099019871 12:77390274-77390296 CCTGGCTCCTCTCCATACACAGT No data
Right 1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG No data
1099019870_1099019878 30 Left 1099019870 12:77390273-77390295 CCCTGGCTCCTCTCCATACACAG No data
Right 1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG No data
1099019873_1099019878 22 Left 1099019873 12:77390281-77390303 CCTCTCCATACACAGTAGGTGTT No data
Right 1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG No data
1099019874_1099019878 17 Left 1099019874 12:77390286-77390308 CCATACACAGTAGGTGTTAAATG No data
Right 1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099019878 Original CRISPR GGTATCTTGTTAGGTGCTAT TGG Intergenic
No off target data available for this crispr