ID: 1099021431

View in Genome Browser
Species Human (GRCh38)
Location 12:77409482-77409504
Sequence TGGAATTACCTGTGAATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099021427_1099021431 27 Left 1099021427 12:77409432-77409454 CCATCAGACATTTTGTCAAAAAG No data
Right 1099021431 12:77409482-77409504 TGGAATTACCTGTGAATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099021431 Original CRISPR TGGAATTACCTGTGAATTAT GGG Intergenic
No off target data available for this crispr