ID: 1099037726

View in Genome Browser
Species Human (GRCh38)
Location 12:77610346-77610368
Sequence ATCTTTATGTCCTCTTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099037723_1099037726 24 Left 1099037723 12:77610299-77610321 CCTGCCGTGTCTCTGATATATAT No data
Right 1099037726 12:77610346-77610368 ATCTTTATGTCCTCTTTGTCAGG No data
1099037724_1099037726 20 Left 1099037724 12:77610303-77610325 CCGTGTCTCTGATATATATACAT No data
Right 1099037726 12:77610346-77610368 ATCTTTATGTCCTCTTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099037726 Original CRISPR ATCTTTATGTCCTCTTTGTC AGG Intergenic
No off target data available for this crispr