ID: 1099037987

View in Genome Browser
Species Human (GRCh38)
Location 12:77613988-77614010
Sequence CTTTCAACACATATGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099037979_1099037987 22 Left 1099037979 12:77613943-77613965 CCCCCTATAACATGAAGTGTATG No data
Right 1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG No data
1099037980_1099037987 21 Left 1099037980 12:77613944-77613966 CCCCTATAACATGAAGTGTATGA No data
Right 1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG No data
1099037981_1099037987 20 Left 1099037981 12:77613945-77613967 CCCTATAACATGAAGTGTATGAT No data
Right 1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG No data
1099037982_1099037987 19 Left 1099037982 12:77613946-77613968 CCTATAACATGAAGTGTATGATT No data
Right 1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099037987 Original CRISPR CTTTCAACACATATGGATGT GGG Intergenic
No off target data available for this crispr