ID: 1099043737

View in Genome Browser
Species Human (GRCh38)
Location 12:77689035-77689057
Sequence CTGCATAAGCAGAAGGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099043729_1099043737 23 Left 1099043729 12:77688989-77689011 CCAGGATAATAGGAAGTGGGTAA No data
Right 1099043737 12:77689035-77689057 CTGCATAAGCAGAAGGGTTAAGG No data
1099043734_1099043737 -10 Left 1099043734 12:77689022-77689044 CCAGGATTTAGGACTGCATAAGC No data
Right 1099043737 12:77689035-77689057 CTGCATAAGCAGAAGGGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099043737 Original CRISPR CTGCATAAGCAGAAGGGTTA AGG Intergenic
No off target data available for this crispr