ID: 1099046697

View in Genome Browser
Species Human (GRCh38)
Location 12:77729361-77729383
Sequence ATTTCATACTTGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099046691_1099046697 21 Left 1099046691 12:77729317-77729339 CCTTCCTAAAGTAGTTTTAATGG No data
Right 1099046697 12:77729361-77729383 ATTTCATACTTGAAGAGTGAAGG No data
1099046693_1099046697 17 Left 1099046693 12:77729321-77729343 CCTAAAGTAGTTTTAATGGCAAG No data
Right 1099046697 12:77729361-77729383 ATTTCATACTTGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099046697 Original CRISPR ATTTCATACTTGAAGAGTGA AGG Intergenic
No off target data available for this crispr