ID: 1099055914

View in Genome Browser
Species Human (GRCh38)
Location 12:77840436-77840458
Sequence GAGGAGAATATGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099055910_1099055914 14 Left 1099055910 12:77840399-77840421 CCAGTAAATGGGTGGGGGACATT 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1099055914 12:77840436-77840458 GAGGAGAATATGATGGAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 298
1099055912_1099055914 -10 Left 1099055912 12:77840423-77840445 CCAAAATACAGATGAGGAGAATA 0: 1
1: 0
2: 3
3: 33
4: 492
Right 1099055914 12:77840436-77840458 GAGGAGAATATGATGGAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099055914 Original CRISPR GAGGAGAATATGATGGAGCA AGG Intronic
903343493 1:22669804-22669826 GAGAAGTATGTGATGAAGCAGGG - Intergenic
903463061 1:23532558-23532580 GAGGAGAAAATCAAGGATCAAGG - Intergenic
903862560 1:26373594-26373616 TTGGAGAATAGGATGGATCAAGG - Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904868994 1:33604815-33604837 AAGGAGAGTATAATGGAGCAGGG + Intronic
905247831 1:36627076-36627098 GAGGAGAGCAAGATGGAGCGAGG - Intergenic
905560027 1:38919112-38919134 GAGGAGAAAATGAGAGAGGATGG - Exonic
905780046 1:40700906-40700928 GTGGAGAATAAGCTGGAGAAGGG - Intronic
906199374 1:43949203-43949225 GAAGAGGATATGGTAGAGCATGG + Intronic
906772119 1:48494595-48494617 GAGTATACTCTGATGGAGCAAGG - Intergenic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
907271064 1:53291405-53291427 GAGGGGAAGATGAGGGAGCGGGG - Intronic
907950751 1:59181284-59181306 GAGTAGGAGATGATGGAGAAAGG - Intergenic
909168689 1:72263965-72263987 GAGTAAAATATGATGGGGAATGG + Intronic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
911435078 1:97845821-97845843 GAGGGGAATGTGATGGTGCCCGG - Intronic
911616696 1:100020656-100020678 GAAGAGCATATGGTTGAGCAGGG + Intronic
912556720 1:110521610-110521632 GAGGAATAGATGATGGAGGAAGG - Intergenic
915562385 1:156694739-156694761 GATGGGAATGAGATGGAGCAAGG + Intergenic
916143800 1:161722741-161722763 GTGGAGAATAGGGTGGACCAAGG + Intronic
917028019 1:170663195-170663217 AAGGAGATTGTGATGGAGAAAGG + Intronic
917511651 1:175674069-175674091 GAGAAGGATATGGTGGTGCAGGG + Intronic
917557167 1:176101946-176101968 GAGGAGAAAATGATAGAGACAGG + Intronic
918340559 1:183564936-183564958 GAGAAAAATAGAATGGAGCAGGG + Intronic
918740826 1:188128475-188128497 GCAGAGATTATGGTGGAGCAGGG + Intergenic
920050101 1:203159230-203159252 GTGGAGAATGTGTTGCAGCAGGG - Intronic
920732060 1:208496796-208496818 GCAGAGATTATGATGTAGCAGGG - Intergenic
922191502 1:223322974-223322996 AAGCAGGATATGATGGAGAAAGG + Intronic
922496022 1:226058612-226058634 GAGGAGGACTTGATGGACCAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
924150157 1:241121808-241121830 GAGGAGAATCTGCTTGAGCTAGG - Intronic
924421719 1:243916363-243916385 GTGTTGAATATGTTGGAGCAGGG - Intergenic
924524956 1:244837837-244837859 GAGTAGGATATGAAAGAGCATGG + Intronic
1063143764 10:3277735-3277757 GAGGAGAACATCACGGTGCAGGG - Intergenic
1063278404 10:4597197-4597219 GAGGAGCAGATGCAGGAGCAGGG - Intergenic
1063974502 10:11404719-11404741 CAGGAGCCTGTGATGGAGCAGGG - Intergenic
1064815605 10:19258554-19258576 GAGGCTAAGATGATAGAGCAGGG - Intronic
1065460002 10:25950615-25950637 CAGGAGAATATGATGGAAAAAGG + Intronic
1066345088 10:34577021-34577043 TCAGAGAAGATGATGGAGCAAGG - Intronic
1068169965 10:53380320-53380342 GAGGAGGATGTGATGGGTCAGGG + Intergenic
1068753603 10:60624906-60624928 GAGGAGAACAAGGTGAAGCAGGG + Intronic
1069201191 10:65618745-65618767 GAGGTGAATTTGGTGGGGCAGGG + Intergenic
1069669732 10:70191683-70191705 TAGGATCATATGATAGAGCAGGG + Intergenic
1070363879 10:75717149-75717171 GAGGAAAATATTTTGGGGCAGGG + Intronic
1071726461 10:88202770-88202792 GAGGTGAATCTGAGGGACCAGGG - Intergenic
1073186301 10:101617211-101617233 GATGAGAAAATGAAGGCGCAGGG + Intronic
1073495087 10:103883582-103883604 GAGGTGAATATGTAGGAGTAGGG - Intronic
1073857891 10:107698327-107698349 GATGGGAATATGCTGGAGTAGGG + Intergenic
1074914995 10:117947094-117947116 GAGGAGAAAGTGATGAAGAAAGG - Intergenic
1076412204 10:130260104-130260126 GAGGAGAGCATGATGCAGAAAGG - Intergenic
1077916366 11:6614356-6614378 GACCTGAGTATGATGGAGCATGG + Exonic
1077923229 11:6656272-6656294 GGGGAGAAAATGATGGAGATGGG - Intergenic
1077978518 11:7275155-7275177 AGGGAGAATCTGCTGGAGCAGGG - Intronic
1078080600 11:8202005-8202027 GACTAGAATATGCTGGAGGAGGG - Intergenic
1080313651 11:30924056-30924078 AAGGAGGATAAGATGGAGCCAGG - Intronic
1080569894 11:33546335-33546357 GAGGAGAGTGGAATGGAGCAGGG - Intronic
1084474945 11:69383542-69383564 GAGAAGAAAAAGCTGGAGCATGG + Intergenic
1085490353 11:76910559-76910581 GAGGAGAAAATTAAGGCGCAAGG + Intronic
1086512447 11:87573899-87573921 GAGGAGAAGACAAGGGAGCAGGG + Intergenic
1087423237 11:97959230-97959252 AAGGAGAAAAGGATGGAGGAAGG + Intergenic
1087550601 11:99642735-99642757 GGGGAGAAGAGGATGGAGAAAGG - Intronic
1087805271 11:102548538-102548560 GAGGAGAAATGGAGGGAGCAAGG + Intergenic
1093197651 12:16147751-16147773 GAGGAGATTATGAAGGAGGTAGG + Intergenic
1093923687 12:24888404-24888426 GAGGAGAATCTGTTGAAGCCAGG + Intronic
1098568192 12:71958645-71958667 GAGGAGAATAGCATGGGGCCTGG - Intronic
1099055914 12:77840436-77840458 GAGGAGAATATGATGGAGCAAGG + Intronic
1099067784 12:78005686-78005708 GAGGAGTGTATGGTGGAGCTAGG - Intronic
1100262703 12:92948006-92948028 GAGGAGAAACTAATGGAGTAAGG + Intergenic
1101045523 12:100801721-100801743 CAGGTGACTTTGATGGAGCAGGG + Intronic
1101598600 12:106189133-106189155 GAGGAGAATGTGCTGGAGAGTGG - Intergenic
1102581665 12:113892344-113892366 TAGGAAAAAATGATGGGGCAAGG + Intronic
1106039450 13:26075706-26075728 GAGAGGAAAATGATGGACCATGG + Intergenic
1106333693 13:28763661-28763683 GAGAAAAATATGTTTGAGCATGG + Intergenic
1107037111 13:35912974-35912996 AAGGAGCATATGAGTGAGCAAGG - Intronic
1107743939 13:43485425-43485447 GACTAGAAAATGATGGAGCCAGG + Intronic
1107914441 13:45134859-45134881 GAGGAGAATGTGATTTTGCAGGG + Intronic
1113409837 13:110075280-110075302 GAGGGGAATATCATGCACCAGGG - Intergenic
1114913863 14:27236776-27236798 CAGGAGAATAAGAGCGAGCAAGG - Intergenic
1117066361 14:52016050-52016072 GAGGAGAGGATGCTGGAGAAAGG - Intronic
1117517886 14:56520670-56520692 GAGGAGAATGTGATGCAGACAGG + Intronic
1117536455 14:56707558-56707580 GAGGAGAATCTGCTGGAGCAGGG - Intronic
1117659736 14:57991291-57991313 CAGGAGTATAGGATGGAGCTGGG + Intergenic
1118288698 14:64501791-64501813 GAGGGGAATGTGAAGGAGCCAGG - Intronic
1118992982 14:70812337-70812359 GAGGGGAATGGGGTGGAGCAGGG + Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121343171 14:93116645-93116667 AAGGAGATTTTGATGGAGCAGGG + Intergenic
1121348937 14:93157316-93157338 GAGTAGTGTGTGATGGAGCAGGG + Intergenic
1124638927 15:31382956-31382978 GAAGACATTATGATGGGGCAGGG - Intronic
1126034971 15:44537240-44537262 GAGGAGAAGTTGCTGGGGCAGGG + Intronic
1127585036 15:60370366-60370388 GAGGAAAAAATCATGGAGCCAGG + Intronic
1127955492 15:63849261-63849283 GAGGGGATTATGATGGGGGAAGG - Intergenic
1128214965 15:65928134-65928156 CTAGAGAATATGATGGAGAAGGG - Intronic
1128601379 15:68998185-68998207 GAGGAGGATATGAGGGCACAGGG + Intronic
1129691780 15:77717899-77717921 GATGAGCTGATGATGGAGCAGGG - Intronic
1129903036 15:79166279-79166301 TAGGAGAACAGGATGGAGCCTGG + Intergenic
1129921522 15:79323114-79323136 CAGAAGGAAATGATGGAGCAGGG - Intronic
1130159695 15:81386295-81386317 GAGGAGAATGGGATGTAGCTGGG - Intergenic
1131082704 15:89550174-89550196 GAGGAGACTAAGGTGGAGAAAGG - Intergenic
1131632713 15:94196109-94196131 GAGACGAATATGATGGAAGAAGG + Intergenic
1133031677 16:3014090-3014112 AAGGAGGTTGTGATGGAGCAGGG - Exonic
1134815795 16:17204794-17204816 GAGGACAGTTTGATTGAGCATGG - Intronic
1135408477 16:22215376-22215398 GAGGAGAGTTTGGTGGTGCATGG + Intronic
1138906287 16:61339084-61339106 GAGGAGAAAATGAAGAAGAAGGG + Intergenic
1139325533 16:66150056-66150078 GAGGAGAAGTCTATGGAGCATGG - Intergenic
1139632479 16:68238954-68238976 GAGGATAGGATGATGGAGCGGGG - Intergenic
1141380888 16:83575622-83575644 GAGGACAATAGGATGGAGCAAGG - Intronic
1146793361 17:35765235-35765257 GAGGAGAAAATGAACGGGCAGGG + Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1148465578 17:47863135-47863157 AAGGAGGATGGGATGGAGCATGG + Intergenic
1150812035 17:68364129-68364151 GTGGAGAAGATTATGGTGCAGGG - Intronic
1151059902 17:71080016-71080038 GGGGAGAGTAAGATGAAGCAAGG + Intergenic
1151309480 17:73284800-73284822 GAAGAGAACAGGATGGAGAATGG - Exonic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152796516 17:82310299-82310321 GAGGAGAATCTTGGGGAGCACGG + Intergenic
1156809627 18:41231646-41231668 GAGAAGAATATGATTGAGAAGGG + Intergenic
1157247386 18:46066671-46066693 GAGGAGAATATCATTAAGGACGG - Intronic
1157496080 18:48158473-48158495 GAGGAGAACATTAAGGACCAGGG - Intronic
1166193865 19:41193755-41193777 GAGGAGAAGCTGATGCAGCTGGG + Intronic
1167687748 19:50967292-50967314 GAGCAGAATAAGTTGGTGCATGG - Exonic
1167702074 19:51054743-51054765 GAGGAGCAGCTGCTGGAGCAGGG - Intergenic
1167717644 19:51154219-51154241 GAGGAGAAGGTGATGGAGAAGGG - Intergenic
1167767083 19:51490651-51490673 GAGGAGAGGGTGATGGAGAAGGG + Exonic
925428688 2:3772519-3772541 GAGGAGGACAAAATGGAGCACGG + Intronic
925581053 2:5411194-5411216 GAGGAGCATATCATGGCTCATGG + Intergenic
926510341 2:13769231-13769253 GAGGTCAAAATGATGTAGCATGG - Intergenic
927108067 2:19844688-19844710 GAGGAAAGTATGAAGGAGCAGGG - Intergenic
927228756 2:20798688-20798710 GAGGGGTATATGATTGTGCATGG + Intronic
929751050 2:44714106-44714128 CAGGAAAATATGATGAAGCCAGG + Intronic
930510361 2:52336764-52336786 GAGGAAATTATGATGGGGAAAGG + Intergenic
931174700 2:59841967-59841989 GAAGAGAGTTTGATGGAACATGG - Intergenic
931265163 2:60653979-60654001 GAGGAGAAGAAGATGGAGAAAGG + Intergenic
931787327 2:65631810-65631832 GAGGCGAAAAAGATGGAGAAGGG - Intergenic
931849701 2:66239872-66239894 GAGGAGAATGTGCTGGAGAAGGG - Intergenic
932050235 2:68390797-68390819 GATGAGAAAATAATGGGGCAGGG - Intronic
932464419 2:71907181-71907203 AAGAAGAATTTGGTGGAGCAAGG - Intergenic
932522573 2:72428533-72428555 GAGGAGTGTATGAGCGAGCATGG - Intronic
933619353 2:84519599-84519621 GAGGAGAATAGGAAGAAGAAGGG - Intronic
934662808 2:96152328-96152350 GAGGGGCATGAGATGGAGCAGGG + Intergenic
938552803 2:132396187-132396209 GGGGAGATTATGATGGGGGAGGG - Intergenic
939842828 2:147209063-147209085 GAGGAGAATAAGACAGAGAAAGG + Intergenic
939916042 2:148044895-148044917 GAGGAAAATAAGAGGCAGCAGGG - Intronic
940488636 2:154328764-154328786 TGGGAGAAAATGTTGGAGCAAGG - Intronic
941474145 2:165927459-165927481 CAGGAGAAAATAATAGAGCATGG - Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
943002859 2:182350888-182350910 GAGCAGAATATTATAGGGCAGGG - Intronic
943346897 2:186749270-186749292 GAGGAGAAAAGAATGGTGCAAGG - Intronic
944403734 2:199358716-199358738 GAGGTTAATATGATGGAAAAAGG - Intronic
944482717 2:200174576-200174598 GAGGACAGTATGATGGGGGATGG + Intergenic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
1171338278 20:24407743-24407765 GAGGGGAAAAGGAGGGAGCATGG + Intergenic
1172170809 20:32930835-32930857 GAGAAGACAGTGATGGAGCACGG - Intronic
1172660325 20:36563682-36563704 GAGGCCAAGATGATGGAGAATGG + Intergenic
1173353489 20:42265791-42265813 CAAGAGAAGATGATGAAGCAAGG - Intronic
1174338564 20:49882224-49882246 GTGGAGAAAATGAGCGAGCACGG - Intronic
1174863047 20:54110663-54110685 GTGGAGTTTATGGTGGAGCAAGG + Intergenic
1174867560 20:54152080-54152102 GAGGAGCACAGGGTGGAGCAAGG - Intergenic
1174985282 20:55444656-55444678 GAGGAGGAGATGATTGAGAAGGG + Intergenic
1175345074 20:58267055-58267077 GAGAAGAATGGGATGGAGGAGGG + Intergenic
1177907132 21:26985391-26985413 GAGGAGAATAAGAGGAAGGATGG + Intergenic
1178794027 21:35726990-35727012 GAGGAGGGTAGGATGGTGCAGGG - Intronic
1178894993 21:36550707-36550729 GAGCAGAGTTGGATGGAGCAGGG - Intronic
1179284502 21:39965764-39965786 GAGGAAAGAATGATGGAGCCAGG + Intergenic
1179551273 21:42145535-42145557 GAAGAGAATCTGATGGAGGAGGG + Intergenic
1180658495 22:17445209-17445231 GAGAAGAATTTGATGCAGCCAGG + Intronic
1181404387 22:22672425-22672447 GAGGAGGAGGAGATGGAGCAGGG + Intergenic
1181845308 22:25702970-25702992 GTGGAGAATCTGCTGGTGCACGG + Intronic
1182844664 22:33420451-33420473 GAGGAGAATAAGGTGGAAAACGG + Intronic
1182847059 22:33439981-33440003 GAGGAGAGCATGGTAGAGCAAGG - Intronic
1183206753 22:36424759-36424781 GAGGAGAGAGTGCTGGAGCAGGG - Intergenic
1183216314 22:36482215-36482237 GAAGAGGAGGTGATGGAGCAGGG + Intergenic
1183366344 22:37409169-37409191 GAGGTGCAGGTGATGGAGCAGGG - Intronic
1184569968 22:45316448-45316470 GAGGAGGATATTAATGAGCAGGG + Intronic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949943647 3:9173530-9173552 GAGGAGAAGATGATGGGGAGAGG + Intronic
950367829 3:12500804-12500826 TATGAGAACGTGATGGAGCAAGG + Intronic
952110201 3:30114135-30114157 AAGGAGAATAATATGGAGCTTGG - Intergenic
952518041 3:34125460-34125482 GAGGAAAGTAGGATGGGGCAGGG - Intergenic
952762598 3:36927872-36927894 GGTGGGAATAGGATGGAGCATGG - Intronic
953098969 3:39807623-39807645 TAGGAGAATAGGAGGGAGAAAGG - Intergenic
954333886 3:49904984-49905006 GAAGAGAATAAGATCCAGCAAGG - Intronic
954764202 3:52898963-52898985 GAGGAGCAGTTCATGGAGCAGGG - Intergenic
955036449 3:55272821-55272843 GAGGAGCTTATGATGGGGGAGGG + Intergenic
955090301 3:55743893-55743915 TAGGAGAATATGGTGGAGGCAGG + Intronic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
956520741 3:70100882-70100904 GAGGAGAATATTATCTAACAAGG - Intergenic
956974191 3:74561255-74561277 GAGGAGAATAGCAAGGAGGATGG - Intergenic
956976346 3:74584900-74584922 GAGGATATTATGATGGAAGATGG - Intergenic
957842124 3:85685278-85685300 GAGAAGAGTATGAAGGACCAAGG - Intronic
958625393 3:96616242-96616264 AAGCAGAAGTTGATGGAGCAAGG + Intergenic
958726609 3:97913285-97913307 GAGGAGAATAGGATGGGAAATGG - Intronic
959224786 3:103565835-103565857 AAGGAGACTAAGATGGAGAATGG + Intergenic
960995429 3:123337119-123337141 GAGAAAAATATGGTGGAGAAGGG - Intronic
962375928 3:134858725-134858747 GAGGACACTAAGGTGGAGCAGGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
964381317 3:156100969-156100991 GAGGAGAATATAATGGATATTGG + Intronic
966260438 3:177971567-177971589 GAGGAGATTACAAAGGAGCAGGG + Intergenic
967158753 3:186717195-186717217 GAGCAGAATCTGATGAAGGAGGG - Intergenic
968009419 3:195264008-195264030 GAGGAGAGGAGGATGGGGCAGGG - Intronic
968660437 4:1796607-1796629 GAGGGGCTTATGATGGAGCAAGG + Intronic
970724067 4:19022644-19022666 GGTGAGAGTATGATGGAGAAGGG - Intergenic
970740829 4:19235670-19235692 GAAGAGAATACACTGGAGCAAGG + Intergenic
973147763 4:46849203-46849225 GGGGAGAAACTGATGGCGCAAGG - Intronic
973970716 4:56211558-56211580 GAGAAGAATTTTATTGAGCAAGG + Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
975445793 4:74463734-74463756 GATGAGAATGGGATGGAGGAGGG + Intergenic
975621402 4:76300229-76300251 GAGGGAAATATGAGGGAGGAAGG - Intronic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
976837994 4:89397870-89397892 GAGGGGATTATAAAGGAGCAAGG + Intergenic
977611975 4:99045239-99045261 GAGAAGTGGATGATGGAGCACGG + Exonic
979115100 4:116813704-116813726 GGGGAGAATATGAAAGAACAAGG - Intergenic
981638656 4:146910897-146910919 GAGGAGAAAAGTATGGAGAAAGG + Intronic
982126081 4:152185115-152185137 TAGGAAAGTATGATGCAGCAAGG - Intergenic
983024817 4:162722561-162722583 GATCAGAATGTGATAGAGCAAGG + Intergenic
983517707 4:168674937-168674959 GAGGAGAGTAAGATGGGGAAAGG + Intronic
983689401 4:170450356-170450378 GTGGAGAATAGTATGGAGAAGGG - Intergenic
984080443 4:175242617-175242639 GAGGAGAAGATGATAGTGCACGG + Intergenic
985575993 5:673723-673745 GAGGTGAATGTGCTGGAGCAGGG + Intronic
989411647 5:41126318-41126340 GAGGAGAAAATTATGGAGAATGG - Intergenic
989508199 5:42252577-42252599 GAGGAGGGTACGATGGAGGAAGG - Intergenic
990401275 5:55439784-55439806 GAGCAGAAAATGATGAAGTATGG + Intronic
991730835 5:69586335-69586357 TAGAAGAATATAATGGAGAAAGG + Exonic
991807271 5:70441497-70441519 TAGAAGAATATAATGGAGAAAGG + Intergenic
991864115 5:71041521-71041543 TAGAAGAATATAATGGAGAAAGG - Exonic
993084938 5:83351551-83351573 GAGGAGAAAATGATATAGTATGG - Intronic
993786295 5:92141978-92142000 GAGTAGAAAATGAAGGAGCCAGG + Intergenic
993913429 5:93711824-93711846 GAGGATAACATGATTGGGCATGG - Intronic
995813931 5:116144908-116144930 GGGGAGAAAATGATGCAGAATGG + Intronic
996792753 5:127310651-127310673 GAGAAGAGAATGATAGAGCATGG - Intronic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
997081464 5:130744837-130744859 AAGGAGCATAGTATGGAGCATGG + Intergenic
997427374 5:133812636-133812658 GAGTAGAAAATGATGGGGGATGG - Intergenic
999019770 5:148152332-148152354 CAGGAAAATATGATGGAGGTGGG + Intergenic
999442511 5:151613465-151613487 GCGGAGAACCTCATGGAGCAAGG - Intergenic
999802814 5:155053556-155053578 GAGGAGAAGAGGATGGAGGGCGG + Intergenic
1001067408 5:168547588-168547610 AAGGAGAACATGATGCAGTATGG - Intergenic
1002701597 5:181128652-181128674 GAGGAGGAGGTGAGGGAGCAAGG - Intergenic
1003443504 6:6164776-6164798 GAGGAGAAAAGGATGGAGGGAGG - Intronic
1003800849 6:9665164-9665186 CAGGAGAAGATGATGGAGATGGG - Intronic
1004155338 6:13162452-13162474 AAGGAGCTTATGATGAAGCATGG - Intronic
1005357068 6:24995112-24995134 GAAGAGAAGATGATGCAGAAAGG - Intronic
1010284949 6:74065928-74065950 GAGGAGCAGAGGATGGAGCTGGG + Intergenic
1013826409 6:114215968-114215990 GATCAGAATATGATGCAGTATGG - Intronic
1015545946 6:134361431-134361453 GAGAAGAAAATGAGGAAGCAAGG - Intergenic
1015862009 6:137691154-137691176 CAGGAGAAGATGATGGCTCAGGG - Intergenic
1016648571 6:146438159-146438181 AAAGAGAATATGATGGTACAAGG + Intergenic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1017913423 6:158814361-158814383 GAGGAAAATCTGATGGGGAAAGG - Intronic
1018457772 6:163967959-163967981 GAGGAGATATTGATGGAGAAAGG + Intergenic
1021198220 7:17696333-17696355 GCTTAGAATATGATGGAGGATGG - Intergenic
1021352303 7:19610035-19610057 GAGGAAGCTATGATGGAGAAAGG - Intergenic
1021673611 7:23058224-23058246 GAGCCAAATATGAGGGAGCATGG - Intergenic
1022145727 7:27538550-27538572 GAAGAGAACCTGATGCAGCATGG + Intronic
1023338291 7:39192909-39192931 AAGGAGAAAAGGATGGAGGAAGG + Intronic
1023529683 7:41139309-41139331 CAGGAAAATATGATGGGCCAAGG + Intergenic
1023764431 7:43497586-43497608 GAGGGGCATAAGATGGAACAGGG + Intronic
1024119044 7:46219031-46219053 GATGAGGATATGATGGAATAGGG + Intergenic
1024311608 7:47974662-47974684 GAGCAGGATAGGAGGGAGCAGGG + Intronic
1025189145 7:56883523-56883545 GAGCAGAATATGATGGAATGAGG - Intergenic
1025682795 7:63693395-63693417 GAGCAGAATATGATGGAATGAGG + Intergenic
1028069325 7:86431542-86431564 GAGGACAATGTGAGAGAGCACGG - Intergenic
1028265936 7:88725657-88725679 GAGGAGAATGTGATTGAGGTTGG + Intergenic
1029093704 7:98068540-98068562 GAGGAGAGAATGATGGAGACAGG + Intergenic
1029152079 7:98487852-98487874 CAGGAGACTATGATGGGGGAGGG - Intergenic
1029897456 7:103999174-103999196 CAGGAAAAAATGAAGGAGCATGG - Intergenic
1029899445 7:104023293-104023315 GAGGAGTGTGTGAGGGAGCATGG - Intergenic
1031105812 7:117541385-117541407 GAGAAGAAAATGAAGAAGCAAGG + Intronic
1031316249 7:120261172-120261194 GAAGAGAATAGGATGGAAAAGGG - Intergenic
1031625754 7:123991198-123991220 AAGGAGAAAATGATATAGCAAGG + Intergenic
1031657303 7:124373808-124373830 GAGAAGCATATTATGCAGCAAGG - Intergenic
1031889921 7:127282111-127282133 GAGGAGAACAGGATGGATGAAGG - Intergenic
1033274825 7:139963915-139963937 GAGGAGAGCATGATGGAGGATGG - Intronic
1033557442 7:142500981-142501003 CAGAAGATGATGATGGAGCAGGG - Intergenic
1034758665 7:153649525-153649547 GAGTAGCATATGAGGGAGGATGG + Intergenic
1035811453 8:2495052-2495074 AAGGAGAATGTATTGGAGCAAGG + Intergenic
1036047284 8:5158011-5158033 GTGGGGAATCTGATGAAGCAGGG - Intergenic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036597495 8:10227156-10227178 GAGGAGCAGATGAAGGAGCTTGG + Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1038082524 8:24155180-24155202 GAGGAGAACAAGTTGGAGCTAGG + Intergenic
1039197000 8:35043759-35043781 GAAAAGAATATGAAGGAGAAGGG + Intergenic
1039328031 8:36506115-36506137 GATCAGAATATTTTGGAGCAGGG + Intergenic
1040105929 8:43541970-43541992 GAGGAGAAGGTGCTGGGGCAGGG - Intergenic
1041106711 8:54452017-54452039 GAGGAGATTAAGATTGAGAAAGG - Intergenic
1041187524 8:55316335-55316357 GAGGAGAGTGGGATGGACCACGG - Intronic
1041761638 8:61373685-61373707 AAGGAGAATAGGAAGGAGAAAGG - Intronic
1042050761 8:64703359-64703381 GAGTAGAATATCATGGTGTAAGG - Intronic
1042604929 8:70535638-70535660 GAGAAGAATTTTATTGAGCAAGG - Intergenic
1042813617 8:72853430-72853452 GAGGAAAGTAGGATGGTGCAAGG - Intronic
1045201384 8:99985458-99985480 GAGGAGAGAATGATGGGGTATGG - Intronic
1045451424 8:102330618-102330640 GAAGAGAATATGAAGTAGAAAGG - Intronic
1046578205 8:116058363-116058385 GAGGAGAATAGGCAGGAGGAAGG - Intergenic
1048808590 8:138264034-138264056 CAGGAGATGAAGATGGAGCAGGG - Intronic
1049982788 9:920244-920266 GTGGAGAATATAAAGGACCAGGG + Intronic
1050061721 9:1716578-1716600 GATTAGAATATGTTGGAGGAGGG + Intergenic
1055101878 9:72474150-72474172 AAGGAGAATATGTATGAGCAGGG - Intergenic
1055133294 9:72800679-72800701 TAAGAAAATATGATGAAGCAAGG - Intronic
1055495960 9:76856155-76856177 GAGGAGTCTGTGATGGACCAGGG + Intronic
1057697046 9:97330621-97330643 GAGGAGAATGTGAAGGGTCAAGG + Exonic
1059057048 9:110994651-110994673 GAGGAGGAGAGGAAGGAGCAGGG + Intronic
1059752217 9:117258543-117258565 GAATAGAAAGTGATGGAGCAGGG - Intronic
1059965569 9:119610234-119610256 GAGGAGAATATGATAAAGGAAGG + Intergenic
1060153034 9:121300723-121300745 GAGGAGAAGAGGATGCACCAGGG - Intronic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185653652 X:1667252-1667274 GAGGAGATCATCCTGGAGCAGGG - Intergenic
1186270887 X:7886885-7886907 GCGGAGAGTATGAAGGAGAAAGG + Intergenic
1188574507 X:31630931-31630953 GCTGAGAATTTGATGGAGTAAGG + Intronic
1189110874 X:38287149-38287171 GAGGAAAATGTGAAGGTGCATGG - Exonic
1191648191 X:63506713-63506735 AAGGAGAATATGAAGATGCAGGG - Intergenic
1194484228 X:94467369-94467391 GAGGAGGATGAGATGGAGAACGG + Intergenic
1195557162 X:106240345-106240367 GAGGAGGGTATGAGGAAGCAGGG - Intergenic
1196548546 X:116994878-116994900 GAGGAGGAAAAGATGGAGAAAGG + Intergenic
1197764985 X:130054429-130054451 AAGGAGAGAAGGATGGAGCAAGG + Intronic
1198039999 X:132841315-132841337 GTGGAGTATATGAAGGACCAAGG - Intronic
1199788279 X:151125743-151125765 GAGGAGAATATCATATACCAGGG + Intergenic
1199844559 X:151681239-151681261 GATGATTATATGATGGATCATGG - Intergenic
1199992888 X:152999012-152999034 GAGGAAAGTGAGATGGAGCAGGG + Intergenic
1200254023 X:154569697-154569719 GAGGAGAAAATGATGGTGCTCGG - Intergenic
1200263746 X:154634711-154634733 GAGGAGAAAATGATGGTGCTCGG + Intergenic
1200832611 Y:7702150-7702172 GAGGAGAAAAAAATGGAGCAAGG + Intergenic