ID: 1099060106

View in Genome Browser
Species Human (GRCh38)
Location 12:77897365-77897387
Sequence CAAAGCTATCGCATGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099060106 Original CRISPR CAAAGCTATCGCATGAAAGG AGG (reversed) Intronic
909008007 1:70299958-70299980 CAAAGATATGGCATGAGAGAAGG + Intronic
917416288 1:174813631-174813653 CAAAGCTATCATAAGAAAGATGG + Intronic
921399113 1:214700876-214700898 AAAAGCTTTTGGATGAAAGGAGG - Intergenic
1074931279 10:118128699-118128721 CAAAGCCAGGGCCTGAAAGGTGG + Intergenic
1082801408 11:57417656-57417678 CAAACCTATCACAGGAGAGGAGG - Intronic
1086095285 11:83044089-83044111 CAAAGCTTTGGCAAGAAACGTGG + Intronic
1090480985 11:127067913-127067935 CAAAGTTATCACATCAATGGTGG - Intergenic
1099060106 12:77897365-77897387 CAAAGCTATCGCATGAAAGGAGG - Intronic
1099387138 12:82028301-82028323 CAAAGGTATCACATGACAGAAGG - Intergenic
1109310997 13:60693069-60693091 CGAAGGTATCCCATGGAAGGAGG + Intergenic
1114159070 14:20142593-20142615 CAAAGCTATGGCCAGAAAAGGGG + Intergenic
1114970078 14:28015867-28015889 CAAATCTAATGCATGCAAGGGGG - Intergenic
1116679254 14:47944897-47944919 TAAAGCTTTCCCATGCAAGGGGG + Intergenic
1116759170 14:48989652-48989674 CAAAGCTAATTCATGAAAGTAGG - Intergenic
1122008238 14:98723807-98723829 CAATTCTATAGTATGAAAGGAGG - Intergenic
1123885825 15:24727462-24727484 CAAAGCTATCTCATGGCAGCTGG + Intergenic
1128653686 15:69441447-69441469 TAAAACTAGGGCATGAAAGGAGG - Intronic
1129299567 15:74617797-74617819 CCAAGCTATGGAATGAAAGCAGG - Intronic
1130220607 15:82016356-82016378 TAAAGCTATCCCTTGAAAAGCGG - Intergenic
1141379761 16:83565951-83565973 AAACGCTATAGCATGAGAGGTGG - Intronic
1144247833 17:13385005-13385027 TAAAGCTTTCCCTTGAAAGGGGG + Intergenic
1151033286 17:70767391-70767413 CACAGCTACCTCAGGAAAGGGGG + Intergenic
1153766682 18:8381534-8381556 CAAAGCTCTTGCCTGAAAGCTGG + Intronic
1156573545 18:38285634-38285656 CAAAGCTGGCCTATGAAAGGTGG - Intergenic
1158408674 18:57185099-57185121 CAAAGCTATCTCATAAATGGAGG - Intergenic
1162652770 19:12103486-12103508 TAAAGCTAAAGCAGGAAAGGAGG - Intronic
926071434 2:9896406-9896428 GAAAGCTAAGGCATGGAAGGGGG - Intronic
929058306 2:37898231-37898253 CAAATCTATCTCATGAGAGATGG + Intergenic
932290397 2:70572421-70572443 CAAAGATATCACAGGAAAGTTGG - Intergenic
933373752 2:81451558-81451580 CATAGCTATCATATGGAAGGGGG + Intergenic
940226503 2:151406898-151406920 CAGATCTATAGCATGATAGGAGG + Intergenic
941617734 2:167740399-167740421 CAAAGACATCTCATTAAAGGTGG - Intergenic
1170800866 20:19589304-19589326 CTAAGTTATCTCATGTAAGGAGG + Intronic
1178534688 21:33402580-33402602 TAAAGCTAGCGCAGCAAAGGAGG - Intergenic
1180374044 22:12074107-12074129 TAAAGCTAAAGCATAAAAGGAGG + Intergenic
951841620 3:27040083-27040105 AAAAGCTTTCCCATGCAAGGGGG - Intergenic
952245093 3:31579299-31579321 CAAATCTAGGGCTTGAAAGGAGG + Intronic
954468303 3:50671005-50671027 CAAAGCTGCCTCCTGAAAGGAGG + Intergenic
954711856 3:52509118-52509140 CAGAGCCAGCCCATGAAAGGAGG + Intronic
957777382 3:84771072-84771094 AAAATCTATAGCAAGAAAGGTGG + Intergenic
959873493 3:111354921-111354943 CAAAGCAATAATATGAAAGGAGG + Intronic
961286586 3:125810307-125810329 CAATGCCAACCCATGAAAGGAGG + Intergenic
965096140 3:164228412-164228434 AAAAGCTTTCCCATGAAAGAAGG - Intergenic
975261735 4:72310287-72310309 CAAAAGTATGGGATGAAAGGTGG + Intronic
980821890 4:138027823-138027845 CAAAGCTATCCAATGAAACATGG + Intergenic
1202755627 4_GL000008v2_random:59546-59568 TAAAGCTAAAGCATAAAAGGAGG + Intergenic
986134074 5:4958184-4958206 CAAAGCTAGAGCATGAGAGACGG + Intergenic
986196082 5:5537323-5537345 CAAAGAAAAGGCATGAAAGGAGG + Intergenic
986774881 5:11005273-11005295 CAAAGCGATCGCAGGCAGGGTGG + Intronic
994587048 5:101722037-101722059 CAAAGATATGGCATTAAAGATGG + Intergenic
998596848 5:143539575-143539597 CAAAACTCTTGCAGGAAAGGTGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1015831562 6:137375507-137375529 CAAAGCTAAGGCAGGAAAGAAGG + Intergenic
1016520983 6:144946186-144946208 CAATGCTATGGTATGAGAGGTGG + Intergenic
1017348164 6:153408603-153408625 AAAAGCTTTCTCATGAAAGAGGG - Intergenic
1017679100 6:156845890-156845912 AAAAGCAATCAGATGAAAGGAGG - Intronic
1018138469 6:160802676-160802698 AAAAGCTTTCCCATGAAAGAGGG + Intergenic
1021408321 7:20299904-20299926 CTAAGCTATAGTATGAGAGGGGG - Intergenic
1021821732 7:24505093-24505115 CAGAGCTACCTCATGCAAGGAGG + Intergenic
1022680726 7:32542980-32543002 CAAACCTATGGCATGGAAGAGGG - Intronic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1026138859 7:67687363-67687385 CATAGCAATAGCAGGAAAGGAGG - Intergenic
1029177927 7:98678073-98678095 CACAGATATCGCATGTAAGAGGG - Intergenic
1041014810 8:53582314-53582336 CAAAGCTTTTACATGAAAAGTGG - Intergenic
1043500482 8:80849468-80849490 CAAATCTATCCCATCAGAGGTGG + Intronic
1203536430 Un_KI270743v1:44382-44404 TAAAGCTAAAGCATAAAAGGAGG + Intergenic
1187274517 X:17806107-17806129 CAAAACTATCTCATGAATTGTGG + Intronic