ID: 1099064911

View in Genome Browser
Species Human (GRCh38)
Location 12:77963917-77963939
Sequence CAGAAGGAGGAGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5971
Summary {0: 1, 1: 6, 2: 72, 3: 755, 4: 5137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099064911 Original CRISPR CAGAAGGAGGAGAAGAAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr