ID: 1099065232

View in Genome Browser
Species Human (GRCh38)
Location 12:77968799-77968821
Sequence ATGTGCTTGTATCAGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099065231_1099065232 0 Left 1099065231 12:77968776-77968798 CCATGAGTTTGAAAAACGTACTC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG 0: 1
1: 0
2: 0
3: 12
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099065232 Original CRISPR ATGTGCTTGTATCAGTGTGA TGG Intronic
904205143 1:28849475-28849497 GTGTATGTGTATCAGTGTGAGGG - Intronic
904573117 1:31482810-31482832 ATTTGCTTCTGACAGTGTGAAGG - Intergenic
905893208 1:41529779-41529801 ATGTGTATGTATGAGTGTGTGGG - Intronic
907664310 1:56420793-56420815 ATATGGGTGTATCAATGTGATGG - Intergenic
908732117 1:67236860-67236882 ATGTGATTTTTTCAGTATGATGG - Intronic
908733656 1:67253124-67253146 ATCAGCTTGAATCAGTGTGAAGG + Intronic
909049993 1:70754953-70754975 TTGTTCTTGTTTCAGTGAGATGG + Intergenic
910947213 1:92607121-92607143 ATGTGTATGTACCAGTGTGTTGG - Intronic
911696228 1:100893376-100893398 ATGCCCTTGGAGCAGTGTGAAGG - Intronic
912895870 1:113588355-113588377 ATGTGGTTGGAGCAGAGTGATGG + Intronic
913988628 1:143587918-143587940 ATGAGCTCCTATCAGTGTCATGG - Intergenic
915722500 1:157994806-157994828 ATGTGTCTGTCTCAGTGTGGGGG - Intronic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
917023791 1:170619299-170619321 ATAAGCTTGTCTCATTGTGACGG - Intergenic
921134452 1:212247656-212247678 ATGTGGTTGTGTCTGTGTGCTGG + Intergenic
921963796 1:221065904-221065926 ATATGCTTGTATGAGTATGAGGG + Intergenic
922669787 1:227500655-227500677 ATGGGCTTGTATTTGTTTGATGG + Intergenic
1063143484 10:3275847-3275869 ATGTGCTTGAATTAGTGAGGGGG + Intergenic
1063523619 10:6762983-6763005 AAATGCTTGTATCAGAGAGAAGG - Intergenic
1067146355 10:43696241-43696263 GTGTGCCTGTGTGAGTGTGAAGG + Intergenic
1068163732 10:53301448-53301470 ATGAGCCTGCATCAATGTGAGGG - Intergenic
1068243748 10:54338024-54338046 ATCTGTTTGTATTTGTGTGAGGG - Intronic
1068329052 10:55537971-55537993 GTGTGATTTTATCATTGTGAAGG - Intronic
1070192715 10:74127279-74127301 ATGTTCTTGTACCACTGTGCTGG + Intronic
1071559982 10:86638207-86638229 ATGTGTTTGTATCCTTGTGATGG + Intergenic
1071934094 10:90507399-90507421 ATGTCTTTGTCTCAGTGTGCAGG - Intergenic
1074869088 10:117563028-117563050 ATGAGTGTGTATCAGTGTGTGGG + Intergenic
1075346502 10:121685866-121685888 ATGGTCTTGAATCAGAGTGAAGG + Intergenic
1078588216 11:12613027-12613049 ATGTATTTGTATCATTTTGAGGG - Intergenic
1079236424 11:18693967-18693989 ATGTTCTGATAACAGTGTGAGGG - Intronic
1080320304 11:31000884-31000906 ATGTGATTGAATCTGGGTGAAGG - Intronic
1085030012 11:73265299-73265321 ATGTGTTTGTATGTGTGAGAGGG - Exonic
1085943899 11:81242351-81242373 ATGTGCTTGTATCAGTGGTGGGG - Intergenic
1086426547 11:86689364-86689386 TTGTGCTGGGATCAGTGTGGAGG + Intergenic
1087636967 11:100712665-100712687 ATGTGCGTGTGTTTGTGTGAGGG + Intronic
1089054017 11:115570033-115570055 ATATTCTTGTATCAGTATGGAGG + Intergenic
1090583279 11:128182941-128182963 ATATGCTTGACTCAGTGTGCTGG - Intergenic
1090608461 11:128449330-128449352 ATGTGTATGTATCAGAGGGATGG - Intergenic
1091465675 12:682030-682052 AAGTCCCTGTATCAATGTGATGG - Intergenic
1093251314 12:16807600-16807622 ATCTGCTTAAATCAGAGTGATGG + Intergenic
1094434518 12:30406652-30406674 AGGTCCTGGTATCAGGGTGATGG + Intergenic
1098879849 12:75905957-75905979 ATGACCTGGTATCAATGTGAGGG - Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1104816311 12:131647797-131647819 ATGTGAGTGTATATGTGTGAGGG - Intergenic
1105457597 13:20555729-20555751 AAGTGCTTATTTCAGTGTAATGG - Intergenic
1105604514 13:21915773-21915795 ATGTGTTTGTGTCTGTGTGAGGG - Intergenic
1107676110 13:42798844-42798866 TTGTGGTTGTATCGATGTGAAGG + Intergenic
1108142460 13:47438804-47438826 CTGTGCATGTATCATTGTCATGG - Intergenic
1108323474 13:49308072-49308094 AAGTGATTGTAACAATGTGAAGG - Intergenic
1108966479 13:56310973-56310995 ATTTGATTGTATCAGTGGTAAGG + Intergenic
1109744543 13:66606215-66606237 TTGTGCTTCTATCAGTGCTAAGG + Intronic
1110411773 13:75212170-75212192 ATGTGCTTGTATCTTTATAATGG - Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1111373726 13:87351925-87351947 ATGTGCTTGTATTACCATGAAGG + Intergenic
1111761417 13:92470750-92470772 ATGTCCTTGAGTCATTGTGAAGG - Intronic
1112182910 13:97102968-97102990 ATGTGTATGTATGTGTGTGATGG - Intergenic
1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG + Intronic
1112640735 13:101272053-101272075 ATGAGCATGTATAAGTGTGTAGG + Intronic
1112952965 13:105024238-105024260 ATGTGCTTTTCTAATTGTGAGGG + Intergenic
1113724822 13:112590513-112590535 ATGTGCCTGTATCTTTGTGATGG - Intergenic
1113948771 13:114059691-114059713 ATGTGCTTGTCTCACTGTGCAGG - Intronic
1115125594 14:29989227-29989249 ATGTCCTTGAATCAGAGGGATGG - Intronic
1118906404 14:70026929-70026951 ATGTGTGTGTATGAGTGTGATGG + Intronic
1123009816 14:105343255-105343277 ATGTCCTTGTCTTTGTGTGAAGG + Intronic
1128815148 15:70602732-70602754 AGGTGCTAGTATCAGGGTTATGG - Intergenic
1129176985 15:73847339-73847361 ATGTGCTTGTATCACTCTTTGGG + Intergenic
1130851354 15:87797247-87797269 ATTTGTTTTTTTCAGTGTGAGGG - Intergenic
1133052085 16:3122929-3122951 CTCTGCTTGGTTCAGTGTGAGGG + Intergenic
1134863494 16:17583265-17583287 ATGTGCCTGTATGTGTGTGCTGG + Intergenic
1137425056 16:48371479-48371501 ATGTGATTCTATCACTTTGATGG - Intronic
1138334080 16:56238534-56238556 ATGTTCTTGCAGCAGTGGGATGG - Intronic
1139233712 16:65312129-65312151 AAGAACTTGTATCACTGTGAGGG + Intergenic
1140783470 16:78317358-78317380 TTGTGTTTGTTACAGTGTGATGG + Intronic
1144432427 17:15206449-15206471 ATGTGCATGTATCTTTGTAATGG - Intergenic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG + Intronic
1147124094 17:38353450-38353472 ATTTGCATGCATGAGTGTGAAGG - Intronic
1148978925 17:51554181-51554203 ATCTGCTGTTATCAGTGTGCAGG + Intergenic
1149722719 17:58862542-58862564 ATATACTTGTATCCTTGTGATGG + Intronic
1151460458 17:74251220-74251242 ATGTGCCTGTATGTGTGTGTGGG + Intronic
1151698345 17:75729568-75729590 CTGAGCTTGTCTCAGGGTGAAGG - Intronic
1152390358 17:80000613-80000635 ACGTGCTCGTATCAGTGTCCTGG - Intronic
1154047352 18:10918686-10918708 ATGTGCTGGTCTTAGTGTGTGGG - Intronic
1154173956 18:12070406-12070428 ATGTGCTGGTCTTAGTGTGTGGG + Intergenic
1155811629 18:30243538-30243560 ATATGCTTATATCACTCTGATGG + Intergenic
1156260668 18:35442900-35442922 ATGTGCTTCGATCAGTGTGGTGG + Intergenic
1158159335 18:54462313-54462335 AAGTGTTTGTATCAATTTGAAGG - Intergenic
1159642365 18:70878212-70878234 ATGTCCTTTTCTCAGTGAGATGG + Intergenic
1162926848 19:13934704-13934726 ATGTGATTGTAAGAGTGTGTGGG + Intronic
1166950342 19:46423110-46423132 ATGAGATTGTATCAGTCTCATGG + Intergenic
1167660906 19:50795307-50795329 GTGTGCATGTGTCTGTGTGACGG + Intergenic
925769695 2:7269916-7269938 ATGTGCCTGTATGAATGTGTGGG + Intergenic
925844007 2:8019562-8019584 GTGTGCATGTATGTGTGTGAGGG + Intergenic
926965074 2:18401066-18401088 GTGTGCTTGTCTCTGTCTGAGGG - Intergenic
929353367 2:40988669-40988691 ATGAGTTTGTATCAATGTCAAGG + Intergenic
929375149 2:41277059-41277081 ATGTGATTGTTTCACTGTGTGGG - Intergenic
929810963 2:45188928-45188950 ATGTGTTTGTGTGAGTGTGTTGG - Intergenic
930489179 2:52046093-52046115 ATGTACTTGTCTCAATGAGAAGG + Intergenic
930851053 2:55960801-55960823 ATGTGCATGCATCTGTGTGTAGG - Intergenic
931061427 2:58533813-58533835 ATGTGCTTTTGACAGAGTGATGG + Intergenic
934238767 2:90251051-90251073 CTGTGCTAGGGTCAGTGTGAGGG - Intergenic
934274429 2:91565659-91565681 CTGTGCTAGGGTCAGTGTGAGGG + Intergenic
936751365 2:115646049-115646071 ATGTGCGTGTGTGTGTGTGATGG - Intronic
937365716 2:121259911-121259933 ATGTACTTGGAACAGTGTGGAGG - Intronic
937904145 2:127044198-127044220 ATGTGAATGTGTGAGTGTGAAGG - Intergenic
937961991 2:127467121-127467143 ATTTTCTTCTATCAGTGTGTGGG - Intronic
939373261 2:141330196-141330218 ATTTGATTACATCAGTGTGAAGG - Intronic
942765196 2:179447097-179447119 ATGTAATTGTATCAGAGGGAAGG - Intronic
944112300 2:196145617-196145639 ATGTGGTTGTAAGAGTGGGATGG + Intronic
944284023 2:197927456-197927478 ATGTTCTTCTATCATTTTGAGGG + Intronic
946464180 2:219896796-219896818 ATGTGCTTGTATAGGTGGGGAGG + Intergenic
947100689 2:226618166-226618188 CTGTGCTTGTGTGAGTGTGCTGG - Intergenic
947823778 2:233090580-233090602 CTGTCCTTGTGTCTGTGTGAGGG - Intronic
947973136 2:234341526-234341548 ATGTGTTTCTATCAGAGTGGCGG + Intergenic
1169987996 20:11468770-11468792 ATTTGCTTTTATAAATGTGAAGG + Intergenic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1173241976 20:41305017-41305039 ATATGCTTCTATCTGTGTAATGG - Intronic
1173826525 20:46051374-46051396 AGGGGCTTGTGTCAGGGTGATGG + Intronic
1174728664 20:52891978-52892000 CGGTGCTTGTGTCATTGTGAAGG - Intergenic
1178819123 21:35959371-35959393 ATGTGGTTGTATAGGAGTGAAGG - Intronic
1179372050 21:40815381-40815403 AGGTTCTTGTGTCTGTGTGAGGG - Intronic
1182319534 22:29469755-29469777 ATGTGCTTGGCTTTGTGTGAAGG - Intergenic
1183718364 22:39547595-39547617 TTGTGCTTGTGTTTGTGTGAGGG + Intergenic
1184118134 22:42433771-42433793 GTGAGCATGTATCACTGTGATGG - Intergenic
949356365 3:3184220-3184242 AGGTGCTTGCAGCACTGTGATGG + Intergenic
949743557 3:7263711-7263733 TCGTGCTGGTAGCAGTGTGACGG + Intronic
949920640 3:8997432-8997454 ATGTGATTGTATGATTGTAAAGG - Intronic
951524717 3:23642994-23643016 CTGTGCTCATCTCAGTGTGAGGG - Intergenic
952528593 3:34240248-34240270 ATGAATTTGTATCAGTGGGAGGG + Intergenic
952871850 3:37907646-37907668 CTGTACGTGTATCAGTGTGGGGG + Intronic
953004861 3:38968966-38968988 ATGTATTTGTATCTGTGTGTGGG - Intergenic
953268825 3:41419704-41419726 AAGTGCTGGCATCACTGTGAAGG + Intronic
959278752 3:104310718-104310740 ATGTGCAGGTATCAATGTAAGGG - Intergenic
959541572 3:107545533-107545555 ATGTGCTTGTATGACTGCTAGGG + Intronic
960548934 3:118951420-118951442 GTGTAGTTGTATCTGTGTGATGG - Intronic
961379294 3:126486889-126486911 ATGTACATGTGTAAGTGTGATGG + Intronic
967759431 3:193206640-193206662 AGGTGATTGTATCATTGGGATGG + Intergenic
968523055 4:1042977-1042999 ATGTGTGTGTGTCAGTGTGTGGG - Intergenic
968642921 4:1723385-1723407 ACATGTTTGTGTCAGTGTGAGGG - Intronic
968741194 4:2332551-2332573 CTGTGCTTGTACCAGGGAGATGG - Intronic
970114594 4:12680160-12680182 ATTTCCTTGTATATGTGTGAGGG - Intergenic
971721042 4:30245608-30245630 AGGTGATTGGATCAGGGTGATGG - Intergenic
974067768 4:57095867-57095889 GTGGGCTTCCATCAGTGTGAAGG + Intronic
977179905 4:93860508-93860530 ATGTATTTGTATAATTGTGAAGG - Intergenic
978963025 4:114707331-114707353 GTGTGCTTGTATCAGGGAAAGGG + Intergenic
979160801 4:117458821-117458843 ATGTGCATGTATGCCTGTGAGGG - Intergenic
980842981 4:138288748-138288770 ATGTGCTTGTATCCCACTGAAGG - Intergenic
981896296 4:149804216-149804238 TTGTGCTTCTGTCAGGGTGAGGG - Intergenic
982333273 4:154206186-154206208 ACGTGCTTGAATCAGGGAGACGG - Intergenic
982405332 4:155013922-155013944 TTATGATTGTATCAGTATGATGG + Intergenic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
986258214 5:6119687-6119709 ATGTGAGTGTATGGGTGTGAGGG - Intergenic
987475859 5:18391979-18392001 ATGTCTTTGCATCAGTGAGACGG + Intergenic
987763538 5:22195501-22195523 ATGTGCTGGTAACACTGTTAAGG + Intronic
990490693 5:56300186-56300208 ATGTGCGAGTATGGGTGTGAGGG + Intergenic
992857881 5:80881977-80881999 ATTTGGTGGTATCAGTGTTATGG + Intergenic
993631459 5:90291074-90291096 GTGTGCTTGTGTGTGTGTGATGG + Intergenic
994022710 5:95046018-95046040 AAGTGCTTATAACAGTGTCAAGG + Intronic
994218430 5:97165803-97165825 ATTTTCTTCTATCACTGTGATGG + Intronic
994672861 5:102783712-102783734 ATGTGCATGCAGCAGTATGAGGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999850162 5:155529061-155529083 ATGTGCTTGTGTAAGTGTAGAGG + Intergenic
1007960351 6:45953379-45953401 GTGTGCTTGTATGAGTGTGGTGG + Intronic
1008935462 6:56987321-56987343 ATGTGCTTGTATCCTAGTTAGGG - Intronic
1009840443 6:69066153-69066175 ATGTGGATGTATATGTGTGAAGG - Intronic
1011810333 6:91124805-91124827 ATGTGCTTGTGTGTGAGTGAGGG + Intergenic
1011816941 6:91203009-91203031 ATGTGGTTGGATCATGGTGATGG - Intergenic
1012206095 6:96462401-96462423 ATGTGTCAGTGTCAGTGTGAGGG - Intergenic
1014044323 6:116866888-116866910 ATCTGCTTGTCCCAGTGTGCTGG + Intergenic
1014549268 6:122770817-122770839 ATGTTCATTTATCTGTGTGATGG + Intergenic
1016124250 6:140380334-140380356 ATTTACTGGTATCTGTGTGATGG + Intergenic
1016125897 6:140402869-140402891 GTGTCCTTGTACCAGTGTTATGG - Intergenic
1021299441 7:18954708-18954730 ATGTGTATGTATGTGTGTGAAGG - Intronic
1021565141 7:22009452-22009474 ATGTGCTTGTCTGGGTGTGGTGG - Intergenic
1022678097 7:32519459-32519481 ACTAGCTTGTATCAGTCTGAAGG - Intronic
1023407212 7:39847524-39847546 CTGTACTTTTCTCAGTGTGAAGG + Intergenic
1024719855 7:52123656-52123678 ATGTGCTTGTATTAGTTTGGCGG + Intergenic
1034297624 7:149988349-149988371 ATCTGCTTGTCCCAGTGTTAGGG + Intergenic
1034808398 7:154108504-154108526 ATCTGCTTGTCCCAGTGTTAGGG - Intronic
1035336459 7:158131730-158131752 ATGTGTGTGTATGAGTGTGTTGG - Intronic
1035353808 7:158265281-158265303 ATGTGCTCGTGTCTGTGTCAGGG - Intronic
1035421999 7:158737446-158737468 CTCTGCTTGTAACAGAGTGACGG + Intronic
1035441554 7:158905978-158906000 AACTGTTTGTATCTGTGTGAGGG - Exonic
1035772559 8:2159764-2159786 TTGTGCTTCTACCACTGTGAGGG - Intronic
1035920657 8:3672422-3672444 GTGTGCTGGTATCAGAGTGTGGG + Intronic
1036809352 8:11856942-11856964 ATGTCCTTTTATCAGTTTGGTGG - Intronic
1036926844 8:12915378-12915400 ATCTCCTTGCATCAGTGTTAAGG + Intergenic
1037133407 8:15433559-15433581 ATGTGTGTGTATACGTGTGAAGG - Intronic
1037460047 8:19099725-19099747 AATTGCTTGTATCTGTGTTATGG - Intergenic
1039365653 8:36925582-36925604 ATGTGCCCTTATCAGTGTGGGGG + Intronic
1042242389 8:66677407-66677429 TTTTGCTTTTATCAGTGTGTTGG + Intronic
1042363188 8:67905953-67905975 ATGTGCTTACATAATTGTGAAGG - Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1045721628 8:105118199-105118221 CTGTTCTTTTATCAGAGTGAAGG - Intronic
1047822971 8:128541605-128541627 ATGTGTGTCTATCAGTGTGTAGG + Intergenic
1052638767 9:31136840-31136862 GTGTGCATGTATTTGTGTGAAGG + Intergenic
1052713379 9:32085391-32085413 ATGTGTGTGTATCTGTGTGTTGG + Intergenic
1052760967 9:32590685-32590707 GTGTGCTTTTATCTGTGTGTGGG + Intergenic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1055251046 9:74305919-74305941 ATGTTATTGTCTCAGTGTTATGG - Intergenic
1062106852 9:134759908-134759930 GTGTGCATGTATGAGTGTGGGGG - Intronic
1062106873 9:134760057-134760079 GTGTGCATGTATGAGTGTGGGGG - Intronic
1062106962 9:134760678-134760700 GTGTGCATGTATGAGTGTGGGGG - Intronic
1185615111 X:1416630-1416652 GTGTGCTTGCATATGTGTGAGGG - Intronic
1187942764 X:24398070-24398092 AAGTGGTTGTAGCAGTGGGAAGG + Intergenic
1188363255 X:29282680-29282702 ATTTGTTTATATCAGTGTGCTGG - Intronic
1189397599 X:40637328-40637350 ATGTACCTGTATCAGAGTGGAGG + Intronic
1189803557 X:44714060-44714082 ATGTGCCTGGATCATGGTGATGG + Intergenic
1190709741 X:53058597-53058619 ATGTGCTTGTATGCGTGAGCAGG + Intronic
1192403029 X:70855992-70856014 ATATGCTTGTATCACTGTATTGG - Intronic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic