ID: 1099067888 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:78006686-78006708 |
| Sequence | TAGCTTGAATTTCTCAAGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 191 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 179} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1099067888_1099067894 | 24 | Left | 1099067888 | 12:78006686-78006708 | CCATGCTTGAGAAATTCAAGCTA | 0: 1 1: 0 2: 0 3: 11 4: 179 |
||
| Right | 1099067894 | 12:78006733-78006755 | CCCCCGCAGCCTCCCAGTTCAGG | 0: 1 1: 0 2: 1 3: 77 4: 538 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1099067888 | Original CRISPR | TAGCTTGAATTTCTCAAGCA TGG (reversed) | Exonic | ||