ID: 1099067888

View in Genome Browser
Species Human (GRCh38)
Location 12:78006686-78006708
Sequence TAGCTTGAATTTCTCAAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099067888_1099067894 24 Left 1099067888 12:78006686-78006708 CCATGCTTGAGAAATTCAAGCTA 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099067888 Original CRISPR TAGCTTGAATTTCTCAAGCA TGG (reversed) Exonic