ID: 1099067890

View in Genome Browser
Species Human (GRCh38)
Location 12:78006716-78006738
Sequence CGGGGGGCGTAAAGCAGTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099067890_1099067904 14 Left 1099067890 12:78006716-78006738 CCCGGACTGCTTTACGCCCCCCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1099067904 12:78006753-78006775 AGGACCTAGTGATGGTGGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 235
1099067890_1099067894 -6 Left 1099067890 12:78006716-78006738 CCCGGACTGCTTTACGCCCCCCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538
1099067890_1099067900 6 Left 1099067890 12:78006716-78006738 CCCGGACTGCTTTACGCCCCCCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1099067900 12:78006745-78006767 CCCAGTTCAGGACCTAGTGATGG 0: 1
1: 0
2: 1
3: 13
4: 109
1099067890_1099067903 10 Left 1099067890 12:78006716-78006738 CCCGGACTGCTTTACGCCCCCCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1099067903 12:78006749-78006771 GTTCAGGACCTAGTGATGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 90
1099067890_1099067902 9 Left 1099067890 12:78006716-78006738 CCCGGACTGCTTTACGCCCCCCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1099067902 12:78006748-78006770 AGTTCAGGACCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099067890 Original CRISPR CGGGGGGCGTAAAGCAGTCC GGG (reversed) Exonic