ID: 1099067891

View in Genome Browser
Species Human (GRCh38)
Location 12:78006717-78006739
Sequence GCGGGGGGCGTAAAGCAGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099067891_1099067902 8 Left 1099067891 12:78006717-78006739 CCGGACTGCTTTACGCCCCCCGC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1099067902 12:78006748-78006770 AGTTCAGGACCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 140
1099067891_1099067894 -7 Left 1099067891 12:78006717-78006739 CCGGACTGCTTTACGCCCCCCGC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538
1099067891_1099067903 9 Left 1099067891 12:78006717-78006739 CCGGACTGCTTTACGCCCCCCGC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1099067903 12:78006749-78006771 GTTCAGGACCTAGTGATGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 90
1099067891_1099067904 13 Left 1099067891 12:78006717-78006739 CCGGACTGCTTTACGCCCCCCGC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1099067904 12:78006753-78006775 AGGACCTAGTGATGGTGGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 235
1099067891_1099067900 5 Left 1099067891 12:78006717-78006739 CCGGACTGCTTTACGCCCCCCGC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1099067900 12:78006745-78006767 CCCAGTTCAGGACCTAGTGATGG 0: 1
1: 0
2: 1
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099067891 Original CRISPR GCGGGGGGCGTAAAGCAGTC CGG (reversed) Exonic