ID: 1099067894

View in Genome Browser
Species Human (GRCh38)
Location 12:78006733-78006755
Sequence CCCCCGCAGCCTCCCAGTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 1, 3: 77, 4: 538}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099067890_1099067894 -6 Left 1099067890 12:78006716-78006738 CCCGGACTGCTTTACGCCCCCCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538
1099067888_1099067894 24 Left 1099067888 12:78006686-78006708 CCATGCTTGAGAAATTCAAGCTA 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538
1099067891_1099067894 -7 Left 1099067891 12:78006717-78006739 CCGGACTGCTTTACGCCCCCCGC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099067894 Original CRISPR CCCCCGCAGCCTCCCAGTTC AGG Exonic