ID: 1099067894

View in Genome Browser
Species Human (GRCh38)
Location 12:78006733-78006755
Sequence CCCCCGCAGCCTCCCAGTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 1, 3: 77, 4: 538}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099067891_1099067894 -7 Left 1099067891 12:78006717-78006739 CCGGACTGCTTTACGCCCCCCGC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538
1099067888_1099067894 24 Left 1099067888 12:78006686-78006708 CCATGCTTGAGAAATTCAAGCTA 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538
1099067890_1099067894 -6 Left 1099067890 12:78006716-78006738 CCCGGACTGCTTTACGCCCCCCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG 0: 1
1: 0
2: 1
3: 77
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099067894 Original CRISPR CCCCCGCAGCCTCCCAGTTC AGG Exonic
900155881 1:1203116-1203138 CCCGCCCAGCCTCCCACTCCAGG - Intergenic
900569150 1:3349856-3349878 CCCCCGCAGCCTCCAAAGCCCGG + Intronic
900941032 1:5798691-5798713 CCCCCGGAGCCTCAGAATTCAGG + Intergenic
901152126 1:7110786-7110808 CCCCCAGGGCCTCCCAGTTTAGG + Intronic
901232407 1:7648635-7648657 CCCCCCAGGCCACCCAGTTCTGG + Intronic
901361409 1:8703605-8703627 ATCACGCAGGCTCCCAGTTCCGG - Intronic
901453939 1:9352745-9352767 CCCCCTCAACCTCCCTGTTATGG + Intronic
901606177 1:10461155-10461177 CCCCCTCGGCCTCCCAGTGCTGG + Exonic
902374372 1:16023394-16023416 CCCCAGGAACCTCCCAGTACAGG + Intronic
902379327 1:16045272-16045294 CCCCAGGAACCTCCCAGTACAGG + Intronic
902509506 1:16958523-16958545 CCCCTGTACCCTCCCAGTTCTGG - Intronic
903236738 1:21955576-21955598 CCTCTGCAGCCTCCCACCTCAGG + Intergenic
903430907 1:23298917-23298939 CTACCTCAGCCTCCCAGGTCTGG + Intergenic
903883491 1:26528390-26528412 CCGCCTCGGCCTCCCAGTGCTGG + Intergenic
903924197 1:26819863-26819885 CCGCCTCAGCCTCCAAGTGCTGG - Intergenic
903964093 1:27075217-27075239 CAACCTCTGCCTCCCAGTTCAGG + Intergenic
904070645 1:27794097-27794119 TCACTGCAGCCTCCCACTTCTGG + Intronic
904251559 1:29228431-29228453 CAACCTCTGCCTCCCAGTTCAGG + Intronic
904700451 1:32354851-32354873 CCTCCTCGGCCTCCCAGTGCTGG + Intronic
905160663 1:36030726-36030748 CCGCCTCAGCCTCCCAATGCTGG + Intronic
905187293 1:36205601-36205623 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
906625884 1:47325259-47325281 CCACCTCGGCCTCCCAGTGCTGG - Intergenic
907113343 1:51947503-51947525 CCTCTGCAGCCTCCCAATACAGG + Intronic
907463765 1:54621813-54621835 CCCCTGCAGCCTCTCAGTGAAGG - Intronic
908076565 1:60525978-60526000 CCACCTCGGCCTCCCAGTTTTGG - Intergenic
908293240 1:62688379-62688401 CAGCCCCAGCCTCCCAGGTCCGG - Intergenic
908708545 1:66989710-66989732 CCGCCTCAGCCTCCCAGTGTTGG + Intergenic
909147736 1:71958704-71958726 CCACCTAAGCCTCCCAGTGCTGG - Intronic
909931466 1:81503747-81503769 CCCCAGCCACCTCCCAGCTCGGG + Intronic
910256648 1:85255262-85255284 CCACCGCACCCTGCCACTTCTGG - Intronic
910689111 1:89948007-89948029 CCGCCTCAGCCTCCCAATGCTGG + Intergenic
914787974 1:150851083-150851105 GCCCCGCAGCCGCCCCGTCCGGG + Intronic
915175668 1:154012754-154012776 CCGCCTCGGCCTCCCAGTGCTGG - Intronic
915385425 1:155487478-155487500 CCACCTCAGCCTCCCAAGTCTGG + Intronic
915490757 1:156248853-156248875 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
915993227 1:160538639-160538661 CCACCTCAGCCTCCCAATACAGG + Intergenic
916854623 1:168737101-168737123 CAACCTCCGCCTCCCAGTTCAGG + Intergenic
917386050 1:174475656-174475678 CCACCTCAGCCTCCCAGAGCTGG - Intronic
919080093 1:192857379-192857401 CCCGGCCAGCCTCCCAGTCCGGG + Intergenic
919212105 1:194500248-194500270 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
919786183 1:201259933-201259955 CCCCGCCAGCCTCCCAGTCCTGG - Intergenic
920029389 1:203027267-203027289 CACTCCCACCCTCCCAGTTCAGG - Intronic
920660475 1:207910646-207910668 CCTCCCCAGTCTCCCGGTTCTGG + Intronic
921527981 1:216241779-216241801 CCGCCTCAGCCTCTCAGTGCTGG + Intronic
921724827 1:218512138-218512160 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
921726795 1:218533244-218533266 CCACCTCAGCCTCCCAGTGCTGG + Intergenic
923569254 1:235099594-235099616 TCACTGCAGCCTCCCACTTCTGG + Intergenic
923615605 1:235534569-235534591 CCGCCTCAGCCTCCCAGTCCTGG - Intergenic
924489886 1:244526158-244526180 CCACCTCAGCCTCCCAATGCTGG - Intronic
1063232683 10:4081187-4081209 CCATCTCAGCCTCCTAGTTCTGG - Intergenic
1063377626 10:5563548-5563570 CCCCGGCAGCTCCCCATTTCCGG - Intergenic
1063449592 10:6142605-6142627 CCACCTCGGCCTCCCAGTGCTGG + Intergenic
1063871405 10:10421463-10421485 GTCCCCCAGCATCCCAGTTCTGG + Intergenic
1065170268 10:23020207-23020229 CAACCTCCGCCTCCCAGTTCAGG + Intronic
1065319270 10:24494077-24494099 ACTCCGCAGCCTCCCAGCTGAGG + Intronic
1066115251 10:32233588-32233610 GCCTGGCAGCCTCCCAGTCCAGG - Intergenic
1068474528 10:57507822-57507844 CCACTGCAGGCTCCCAGATCTGG - Intergenic
1068536845 10:58249331-58249353 CCACCCCAGCCTCCCAGGGCTGG + Intronic
1069001953 10:63276708-63276730 CCTCCTCAACCTCCCAGTGCTGG + Intronic
1069378976 10:67822738-67822760 CCACCTCGGCCTCCCAGTGCTGG - Intronic
1069751833 10:70749904-70749926 CCACCGCATCCTCCCACTCCAGG - Exonic
1069886056 10:71624287-71624309 CCCCTGCAGCATCCCTTTTCAGG + Intronic
1070329613 10:75408128-75408150 CCCGCGCAGCCTCTCAGGGCCGG - Intergenic
1072162599 10:92782332-92782354 CGGCCTCAGCCTCCCAGTGCTGG - Intergenic
1072542089 10:96406194-96406216 CCCCTGCAGCCCACCAGCTCGGG + Intronic
1072974917 10:100049204-100049226 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1073009518 10:100348433-100348455 CCCTCCCAGCCTCCCGGTTGGGG + Intronic
1073053423 10:100684017-100684039 CCCCTGCAGCCCCCCAGGTTTGG - Intergenic
1074042968 10:109810418-109810440 CCTCCTCAGCCTCCCAATGCTGG - Intergenic
1074474663 10:113759320-113759342 CAACCTCTGCCTCCCAGTTCAGG - Intronic
1074688686 10:115982844-115982866 CCCCCACAGCCACCCAGCCCTGG - Intergenic
1074895409 10:117773153-117773175 CCCCCACAGCTTCCAAGTGCTGG + Intergenic
1076011757 10:126994918-126994940 ACCCGGCAGCCACCCCGTTCGGG - Intronic
1076108784 10:127845634-127845656 CCCAAGGAGCCTCCCAGTGCTGG - Intergenic
1076530581 10:131141835-131141857 CCCACCCAGCCTCCCAGCTGAGG + Intronic
1076751416 10:132545350-132545372 CCCCCTCAGCCGCCCCGATCTGG - Intronic
1077227617 11:1445232-1445254 CCCTCGCAGCCGCCCAGGCCCGG + Intronic
1077298297 11:1836109-1836131 ACCCCGCTGGCTCCCAGATCAGG + Exonic
1077473465 11:2775647-2775669 CCACCCCAGGCTACCAGTTCTGG - Intronic
1077542437 11:3153520-3153542 CCCCCGCAGCTTGCCAGAGCAGG - Intronic
1077680784 11:4237974-4237996 GCCCGGCAGCCTCCCTGTCCGGG + Intergenic
1077778856 11:5302590-5302612 TCCCTGCAGCCTCACAGTCCTGG - Intronic
1078216719 11:9318008-9318030 CCACCTCGGCCTCCCAGTGCTGG + Intergenic
1078275381 11:9839985-9840007 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1078696063 11:13633150-13633172 GCCTCACAGCCTCCCAGTTCAGG + Intergenic
1079621920 11:22566369-22566391 CCCCTGCTGCCTCCCAGCTGTGG - Intergenic
1081060422 11:38468103-38468125 CCTCCTCAGCCTCCCAGTTTTGG - Intergenic
1081617567 11:44599813-44599835 CCCCCGACTCCACCCAGTTCAGG - Intronic
1081950395 11:47038601-47038623 CCCGGCCAGCCTCCCAGTCCGGG - Intronic
1081965377 11:47166109-47166131 CCATCTCAGCCTCCCAGTGCTGG + Intronic
1083272568 11:61579836-61579858 CACCCCCAGTCTGCCAGTTCTGG - Intronic
1083641210 11:64146356-64146378 CCCCCGCAGGCCCCCTCTTCTGG - Intronic
1084325066 11:68395513-68395535 CCCCAGCAGTCCCCAAGTTCTGG - Intronic
1084372385 11:68752181-68752203 CACCCGCAGCGTCCCAGGCCGGG - Intergenic
1085001631 11:73042172-73042194 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1085040562 11:73324109-73324131 CCCCCTCAGCTTCCCAGCCCAGG + Intronic
1085109601 11:73876014-73876036 CCGCCTCAGCCTCCCAGTGTTGG - Intronic
1085354914 11:75827360-75827382 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1086205438 11:84252393-84252415 CCGCCTCAGCCTCCCAATACAGG + Intronic
1088089520 11:106021984-106022006 CCTCCCCAGCCTCCCCGGTCAGG + Exonic
1088257144 11:107912645-107912667 GCCCTGCAGCCACCCCGTTCGGG + Intronic
1088270344 11:108027654-108027676 CCGCCTCAGCCTCCCAGTGTTGG + Intronic
1088937039 11:114412867-114412889 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1090280695 11:125453721-125453743 CCTCTGCAGCTTCCCAGCTCTGG - Intronic
1090686713 11:129129385-129129407 GCCCGGCAGCCGCCCAGTCCGGG + Intronic
1091749528 12:3013797-3013819 CCACCGCAGCCTCCAACTCCTGG - Intronic
1091751623 12:3025189-3025211 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1092155828 12:6280969-6280991 CCACCCCAGCCTCCCACTCCTGG + Intergenic
1092168298 12:6356698-6356720 CCCACACAGCCTCCCTGTTCTGG - Intronic
1092396373 12:8130627-8130649 CCACCTCAGCCTCCCCGTGCTGG + Intronic
1092777926 12:11960293-11960315 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
1092843838 12:12566207-12566229 GCCCGGCAGCCACCCAGTCCGGG + Intergenic
1094493400 12:30975333-30975355 CACCCGCAGCCTCCCTGCTGTGG + Intronic
1094494316 12:30979924-30979946 CCCCTGCTGCCTTCCCGTTCTGG + Intronic
1094621192 12:32082041-32082063 CCACCTCAGCCTTCCAGTGCTGG + Intergenic
1094684832 12:32701025-32701047 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1095825972 12:46530978-46531000 CCCCTGCAGCCCCCCACCTCTGG + Intergenic
1095905199 12:47370136-47370158 TCACTGCAGCCTCCCACTTCTGG + Intergenic
1096402452 12:51318507-51318529 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1096466485 12:51849516-51849538 CCCCCGCAGCCACCCGCTCCCGG - Intergenic
1096725097 12:53555070-53555092 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1096853378 12:54458451-54458473 CAACCTCTGCCTCCCAGTTCAGG + Intronic
1097679167 12:62632740-62632762 CCCCTGCAGCCTCGCACATCTGG + Intergenic
1099067894 12:78006733-78006755 CCCCCGCAGCCTCCCAGTTCAGG + Exonic
1099612941 12:84898090-84898112 CCATCTCAGCCTCCCAGTGCTGG - Intronic
1099844611 12:88013897-88013919 CACCCACAGGCTCTCAGTTCTGG - Intronic
1100284873 12:93155795-93155817 TCCCCGCAGCCTCCAACTCCTGG + Intergenic
1101230184 12:102732757-102732779 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
1101353507 12:103955557-103955579 TCACCGCAGCCTCACATTTCTGG - Intronic
1101520305 12:105475996-105476018 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1101674966 12:106909206-106909228 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1101845277 12:108358575-108358597 CCCTCGCAGCCTGCCAGGTGTGG + Intergenic
1101891731 12:108722445-108722467 CCCCAGGAGCCTCCCTGTGCAGG - Intronic
1101962516 12:109260450-109260472 GCAAAGCAGCCTCCCAGTTCAGG - Intronic
1102110448 12:110361540-110361562 CCACCTCAGCCTGCCAGTGCTGG - Intergenic
1102474852 12:113181902-113181924 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1102479231 12:113209631-113209653 CCACCTTAGCCTCCCAGTGCTGG + Intronic
1102933390 12:116879020-116879042 CGCCCGCAGCCTCCCCTTCCAGG + Intronic
1102959682 12:117084645-117084667 CCCTCCCATCCTCCCTGTTCTGG - Intronic
1103077756 12:117998369-117998391 TCACTGCAGCCTCCCAGTCCAGG + Intergenic
1103293245 12:119864581-119864603 CCACCTCGGCCTCCCAGTGCTGG + Intronic
1103525634 12:121566239-121566261 CCGCCTCAGCCTCCCAGTGTTGG - Intronic
1103637143 12:122316455-122316477 CCACCTCAGCCTCCCAGTGATGG + Intronic
1103850750 12:123931559-123931581 CCTCCTGAGCCTTCCAGTTCTGG - Intronic
1104906027 12:132214007-132214029 CCCCCGCTCCCTGCCAGGTCAGG + Intronic
1105501255 13:20974826-20974848 CACTCGCTGCCTCCCAGGTCAGG - Exonic
1106569494 13:30914257-30914279 CATCCCCAGCCTCCCAGTTATGG - Intronic
1106597756 13:31161455-31161477 CCCTCGCAGACTCCCACTTACGG + Exonic
1106680129 13:32000205-32000227 GCCCGGCAGCCACCCCGTTCGGG + Intergenic
1107407888 13:40131934-40131956 TCCCCTCAACCTCCCAGTCCTGG + Intergenic
1107858459 13:44638161-44638183 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1108893081 13:55286850-55286872 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1110237377 13:73230869-73230891 CCCCCGCATTCTCCCAGTATGGG + Intergenic
1110556326 13:76863679-76863701 CCACCTCAGCCTCCCAGATCTGG + Intergenic
1110959692 13:81606272-81606294 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
1111418337 13:87976658-87976680 GCCCGGCAGCCGCCCAGTCCAGG - Intergenic
1111591701 13:90355665-90355687 CCACCTCAGCCTACCAGTACTGG - Intergenic
1112505103 13:99970655-99970677 CCGCCGCAGCCGCCAGGTTCAGG + Exonic
1112953615 13:105033282-105033304 TCACCGCAGCCTCCAAGTGCTGG + Intergenic
1113565725 13:111318560-111318582 CTCCCGCAGCTTCCCGGTGCTGG + Intronic
1113983290 13:114294379-114294401 CCGCCTCAGCCTCCCATTACAGG + Intronic
1117145900 14:52836630-52836652 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
1117850674 14:59965634-59965656 CCACCTCGGCCTCCCAGTGCTGG - Intronic
1119657412 14:76427008-76427030 CCCCTGCAGCATCTCTGTTCAGG - Intronic
1120117995 14:80642834-80642856 CAACCTCAGCCTCCCAGTTCAGG + Intronic
1121304630 14:92898423-92898445 ACTCCGCAGCCTCTCAGCTCTGG + Intergenic
1121756376 14:96406164-96406186 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1122162463 14:99793864-99793886 CCCGGGCAGCCTCCGCGTTCCGG + Intronic
1122594310 14:102878836-102878858 CCCTCTCACCCTCCCAGTTCTGG - Intronic
1122825556 14:104368873-104368895 CCCACAGAGCCTCCCAGTTAGGG + Intergenic
1122900407 14:104779981-104780003 CCCCTGGAGCCTCCAAGTCCTGG - Intronic
1122996534 14:105268332-105268354 CCCACGCAGCCTCCCTGGGCTGG + Intronic
1123975849 15:25553913-25553935 CCACCTCAGCTTCCCAGTGCTGG - Intergenic
1125600874 15:40915292-40915314 CCCCCTCAGCCTCCCAGCTTGGG - Intergenic
1125669146 15:41457284-41457306 CCACCTCGGCCTCCCAGTGCTGG - Intronic
1126031574 15:44504619-44504641 TCACCTCAGCCTCCCAGTGCAGG - Intronic
1126299924 15:47184207-47184229 TCCCCGCTGCCTCCTAGTCCTGG - Intronic
1126461715 15:48921580-48921602 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1127201335 15:56655452-56655474 CCACCTCGGCCTCCCAGTGCTGG + Intronic
1127916405 15:63459077-63459099 CGCCTGCAGCAGCCCAGTTCCGG - Intergenic
1128458644 15:67849177-67849199 CCCTTGCAGCCTCCAAGTCCTGG - Intergenic
1129167413 15:73786668-73786690 CCAGCCCAGCCTCCCAGCTCTGG + Intergenic
1129173054 15:73819617-73819639 CCACCTCAGCCTCCCAGTGTAGG + Intergenic
1129187986 15:73922347-73922369 CCCCCACAGCATGCCAGCTCAGG + Intergenic
1129295128 15:74596052-74596074 CCCCAGCCACCTCCCAGCTCAGG + Exonic
1130399113 15:83532707-83532729 CACCAGCAGCCTCCCATCTCTGG - Intronic
1131201993 15:90406410-90406432 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1132700387 16:1219778-1219800 CCCCGGGAGCCTCACAGGTCAGG + Intronic
1132757355 16:1492419-1492441 CCACCTCAGCTTCCCAGTGCTGG + Intergenic
1132759839 16:1503316-1503338 CCGCCTCAGCCTTCCAGTGCTGG - Intronic
1132792987 16:1703801-1703823 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1133156661 16:3880752-3880774 CCCCCACCCCCTCCCCGTTCAGG - Intergenic
1133240238 16:4409793-4409815 CCCCTTCAGCCTCTCAGCTCAGG - Intronic
1133587679 16:7211743-7211765 CCCCCGAGTCCTCCTAGTTCAGG - Intronic
1133762934 16:8814237-8814259 CCACCTCGGCCTCTCAGTTCTGG + Intronic
1134126335 16:11618695-11618717 CCCCCGCGGCCGGCCAGTGCGGG - Intronic
1134167203 16:11940489-11940511 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1134581684 16:15376667-15376689 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1134816554 16:17210657-17210679 CCCCTTCAGCCTCCCAGTGCTGG + Intronic
1135136153 16:19886180-19886202 CCCTGCCAGCCTCCCAGTTCCGG + Intergenic
1135283378 16:21172196-21172218 CCTCCTCAGCCTCCCAGTGTTGG - Intronic
1135292046 16:21248270-21248292 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1135312598 16:21417948-21417970 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1135365546 16:21850401-21850423 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1135446293 16:22520935-22520957 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1135867543 16:26118138-26118160 TCACCGCAGCCTCCAACTTCTGG + Intronic
1136068739 16:27775700-27775722 CCCCTGCAGCCTCTCAGCCCAGG + Intronic
1136226051 16:28861376-28861398 CCGCCTCAGCCTCCCAGTGTTGG + Intronic
1136241450 16:28946975-28946997 CCACCTCAGGCTCCCAGTGCTGG + Intergenic
1136309300 16:29396900-29396922 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1136322718 16:29498456-29498478 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1136346543 16:29679512-29679534 CCCAACCAGCCTCCCACTTCCGG - Intronic
1136437400 16:30238424-30238446 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1136475592 16:30511173-30511195 CCACCGCAGCCTCCCAACCCAGG + Intronic
1137537173 16:49336316-49336338 CCTCCGCAGCCTCCTTGGTCTGG + Intergenic
1138120275 16:54395762-54395784 CCCCAGCAGCCTCTCAATACAGG - Intergenic
1139183001 16:64770172-64770194 CAGCTGCAGCCTCCCAGTTGTGG + Intergenic
1139814641 16:69658579-69658601 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1140219486 16:73033399-73033421 CCCCCGCCGCCCCCCAGCACTGG + Intronic
1141708520 16:85683511-85683533 CTCCTGCAGCCTCCCACCTCAGG + Intronic
1141793717 16:86254281-86254303 CCTCCTCAGCCTCCCGGTGCTGG + Intergenic
1142000112 16:87659472-87659494 CCACCTCAACCTCCCAGTGCTGG - Intronic
1142142363 16:88478335-88478357 CACCCGCAGCTCCTCAGTTCGGG - Intronic
1142983262 17:3683481-3683503 CCACCTCGGCCTCCCAGTGCTGG - Intronic
1143098232 17:4489898-4489920 CCACCTCAGCCTCCCAGAGCTGG - Intergenic
1143179358 17:4974487-4974509 CCCCCTCAGACAACCAGTTCCGG - Exonic
1143213970 17:5210312-5210334 CACCCACAGCCTCACAGTGCAGG + Exonic
1143449307 17:7026476-7026498 CTGCCACAGCCTCACAGTTCTGG - Exonic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1143642841 17:8209258-8209280 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1144063724 17:11605750-11605772 CCTCCTCAGCCTCTCAGTGCTGG + Intronic
1144203240 17:12960318-12960340 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1144781218 17:17809594-17809616 CCCCCGCCGCCGTCCAGCTCAGG + Intronic
1144828788 17:18120796-18120818 CCCCCGCGGCCCCCAAGCTCCGG + Exonic
1144992624 17:19244209-19244231 CAGCCTCAGCCTCCCAGTGCTGG - Intronic
1145856691 17:28165965-28165987 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1145873928 17:28301361-28301383 CCCGCTCAGCCTCCCAGTGTTGG + Intergenic
1147154708 17:38538169-38538191 CCACCTCAGCCTCCCAGTGCTGG - Intronic
1147665945 17:42148159-42148181 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1147752764 17:42746428-42746450 CCACCTCTGCCTCCCAGTGCTGG + Intergenic
1147848142 17:43419820-43419842 CCGCCTCAGCCTCACAGTGCTGG + Intergenic
1148051237 17:44770865-44770887 CCACCTCAGCCTCCCAGTGATGG - Intronic
1148337554 17:46851694-46851716 CCGCCGCCGCCTCCTACTTCGGG + Exonic
1149122669 17:53189124-53189146 CCACCTCGGCCTCCCAGTGCTGG - Intergenic
1149930794 17:60753089-60753111 CCATCTCAGCCTCCCAGTGCTGG + Intronic
1150084925 17:62268499-62268521 GCCCAGCACCCACCCAGTTCCGG - Intergenic
1150136687 17:62699653-62699675 CCACCTCTGCCTCCCAGTGCTGG + Intergenic
1150217012 17:63476694-63476716 CCCCCGGAGCCTCCCGCCTCCGG - Intergenic
1150493430 17:65589818-65589840 CCGCCTCAGCCTCCCAGTGCTGG - Intronic
1151237377 17:72730997-72731019 CCGCCTCGGCCTCCCAGTGCTGG + Intronic
1151310266 17:73288504-73288526 CCACCTCGGCCTCCCAGTGCTGG + Intronic
1151450882 17:74197589-74197611 CCTCCCCAGCCTCACAGGTCTGG + Intergenic
1151628252 17:75291445-75291467 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
1151706121 17:75768845-75768867 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1151781063 17:76245776-76245798 CCGCGTCAGCCTCCCAGTGCTGG - Intergenic
1151898015 17:76993428-76993450 CTGCCTCAGCCTCCCAGTGCTGG + Intergenic
1151965877 17:77431091-77431113 CCACCGCAGCCTCCCAAAGCTGG - Intronic
1152485435 17:80588408-80588430 CCTCCTCAGCCTCCCAGTGTTGG + Intronic
1152718457 17:81911123-81911145 GCCCCGCAGCCTGCCAGCCCCGG + Intronic
1153245745 18:3071604-3071626 CCGCCTCAGCCTCCCAGTGTTGG + Intronic
1153649592 18:7228341-7228363 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1153860706 18:9202073-9202095 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1153883437 18:9440273-9440295 CAACCTCTGCCTCCCAGTTCAGG - Intergenic
1154118479 18:11632602-11632624 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
1154222760 18:12471569-12471591 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1155495859 18:26441038-26441060 CCGCCTCAGCCTCCCAGTGTTGG - Intergenic
1156369889 18:36463741-36463763 CCGCCTTAGCCTCCCAGTGCTGG + Intronic
1156480279 18:37432051-37432073 GCCTCACAGCCTCCCAGCTCAGG - Intronic
1157576929 18:48749880-48749902 GCCCTGCAGTCTCCCAGATCCGG - Intronic
1158547855 18:58411041-58411063 CCACTGCAGCCTCCAACTTCTGG - Intergenic
1158897532 18:61929035-61929057 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
1158986323 18:62821180-62821202 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1160250899 18:77202774-77202796 CCCCCACAGCCTCCCATGACAGG + Intergenic
1160542302 18:79630788-79630810 GCACCACAGCCTCACAGTTCTGG + Intergenic
1160709282 19:543595-543617 CCACCTCGGCCTCCCAGTGCTGG - Intergenic
1160747489 19:718943-718965 CCCCAGCTGCTTCCCAGTCCCGG - Intronic
1160864967 19:1252410-1252432 CCCCCGCCCCCTCCCCTTTCGGG - Intronic
1160906604 19:1454489-1454511 CCACCTCAGCCTCCCATGTCAGG + Intronic
1160953355 19:1678072-1678094 CCCCTGCAGCCCCCCAATGCCGG + Intergenic
1161465977 19:4430707-4430729 CCCCGTCACCCTCCCAGGTCAGG - Intronic
1161760083 19:6164676-6164698 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1162292153 19:9788276-9788298 CTGCTGCAGCCTCCCAGTGCTGG + Intronic
1162535846 19:11262486-11262508 CCGCCGCCGCCTCCCGGTTCTGG + Intergenic
1163174633 19:15555864-15555886 ACCCCTCAGGCTCCCAGTCCTGG + Intergenic
1163528125 19:17833600-17833622 CCACCTCAGCCACCCAGTGCTGG - Intronic
1165396690 19:35568265-35568287 CCGCCTCAGCCTCCTAGTGCTGG - Intergenic
1165489645 19:36115729-36115751 CCCTCCCAGCCTCCCCCTTCCGG - Intronic
1165694599 19:37891409-37891431 CCACCTCAGCGTCCCAGTGCTGG + Intronic
1165747492 19:38238657-38238679 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
1165852404 19:38857300-38857322 CCACCTCGGCCTCCCAGTGCTGG - Intergenic
1166359605 19:42247689-42247711 CCCCCTCTGCCTCCCAGCTGGGG - Exonic
1166539489 19:43595801-43595823 CCACTGCAGCCTCCAAGTCCTGG - Intronic
1166793216 19:45410132-45410154 CTGCCTCAGCCTCCCAGTGCTGG + Exonic
1167156144 19:47740498-47740520 CCGCCTCAGCCTCCCAATGCTGG - Intronic
1167190784 19:47987877-47987899 CCAACTCAGCCTCCCAGTACGGG - Intronic
1167289670 19:48617466-48617488 CCCCCGCAGCCTTCCAGTGAAGG + Intronic
1167322024 19:48802945-48802967 CCACCTTAGCCTCCCAGTTCTGG - Intronic
1167744705 19:51343751-51343773 CCGCCTCAGCCTCCCAGTGTTGG + Intergenic
1168332698 19:55579303-55579325 CCCCCGCACCTTCCCAGAACCGG - Exonic
1168639658 19:58022465-58022487 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
925415871 2:3669796-3669818 CCATCGCAGCCTCCCACCTCCGG - Intronic
925964055 2:9046720-9046742 CCACCTCAGCCTCCCAAGTCTGG + Intergenic
927196413 2:20550677-20550699 CCACCTCGGCCTCCCAGTTTAGG - Intergenic
927915103 2:26930573-26930595 CTGCCGCAGCCTCCCAGTGCTGG - Intronic
928155007 2:28868763-28868785 CCACCTCGGCCTCCCAGTGCTGG - Intronic
928408950 2:31038991-31039013 CCACCTCAGCCTTCCAGTGCTGG + Intronic
928437909 2:31267792-31267814 CCCCTGCAGCCTCCCAGGACAGG + Exonic
928742239 2:34368849-34368871 GCCCCGCAGCCTCCAAGATGAGG - Intergenic
929195564 2:39180934-39180956 CCACCTCGGCCTCCCAGTGCTGG + Intronic
929202164 2:39246990-39247012 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
930154153 2:48088497-48088519 TCCCTGCAGCCTCCGAGTTCTGG - Intergenic
930484331 2:51993665-51993687 CCGCCTCAGCCTCCCATTACTGG + Intergenic
930665582 2:54096070-54096092 GCCCCGCAGCCACCCCGTCCGGG - Intronic
930667754 2:54116008-54116030 ACCCAGCAGCCGCCCACTTCTGG - Intronic
930805462 2:55485070-55485092 CCACCTCAGCCTCACAGTCCTGG + Intergenic
930839218 2:55826463-55826485 CCCCCGCTGCCTCCAAGCTGGGG + Intergenic
932531381 2:72537352-72537374 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
934568308 2:95352717-95352739 CCTCCCCTGCCTTCCAGTTCAGG + Intronic
934576631 2:95405847-95405869 CCCCTGCACCCTCCCCGCTCTGG + Intronic
934638853 2:96014015-96014037 CCCCCACATCCTCCCCGCTCTGG + Intergenic
934736040 2:96690368-96690390 CCGCAGCAGCCTCCCACTCCAGG - Intergenic
934794798 2:97091396-97091418 CCCCTGCACCCTCCCCGCTCTGG - Intronic
935002519 2:99033591-99033613 CCACCTCAGCCTCCCAGTGCTGG - Intronic
935847581 2:107183562-107183584 CCTCCTCAGCCTCCCAGTGTTGG - Intergenic
935872222 2:107463472-107463494 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
936083253 2:109449393-109449415 CCCCTCCAGCCTCCCCGTTGAGG - Exonic
936252108 2:110874904-110874926 CCTCGGCGACCTCCCAGTTCAGG - Intronic
936757652 2:115734406-115734428 CCACCTCGGCCTCCCAGTGCTGG - Intronic
937066399 2:119021026-119021048 CCCCCGGAGGCTCCCAGTCTTGG - Intergenic
937233986 2:120419379-120419401 CTCCCACATCCTCCCAGCTCAGG + Intergenic
937922763 2:127143523-127143545 CCACCTCAGCCTCCCGGTGCTGG - Intergenic
937925535 2:127165019-127165041 CCCACACAGGCTCCCAGTGCAGG - Intergenic
938253395 2:129833622-129833644 GCCCAGCAGCCGCCCAGTCCAGG + Intergenic
938727554 2:134120947-134120969 TCCCTGCAGCCTCCCAGACCCGG - Intronic
938792640 2:134690531-134690553 CAGCCTCAGCCTCCCAGTGCTGG + Intronic
938893281 2:135726722-135726744 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
939505991 2:143047806-143047828 CCTCCTCAGCCTCCCATTACAGG + Exonic
941052070 2:160746423-160746445 CACCATCAGCCTCCCAGTTTGGG + Intergenic
941621929 2:167788264-167788286 CCCCCGCCCCCACCCACTTCCGG - Intergenic
941648668 2:168069163-168069185 CCGCCTCAGCCTCCAAGTGCTGG + Intronic
941768745 2:169327054-169327076 GCCCGGCAGCCGCCCAGTCCGGG + Intronic
941786640 2:169505796-169505818 GCCCGGCAGCCACCCAGTCCGGG + Exonic
941799560 2:169642796-169642818 CTGCCTCAGCCTCCCAGTTATGG - Intergenic
941829146 2:169935238-169935260 CCACTGCAGCCTCCAACTTCTGG + Intronic
942407503 2:175671197-175671219 CCGCCTCAGGCTCCCAGTGCTGG - Intergenic
942639075 2:178041487-178041509 CCGCCTCAGCCTCCAAGTGCTGG + Intronic
944570847 2:201042672-201042694 GCCCGGCAGCCGCCCAGTCCGGG + Intronic
945542320 2:211104326-211104348 CCCCTGCAGCCTCTCTCTTCTGG + Intergenic
945737190 2:213615341-213615363 CCGCCTCAGCCTCCCAGTGCTGG - Intronic
946311888 2:218886638-218886660 CCACCGCTGCCTCCCTGCTCCGG + Intronic
946394147 2:219434927-219434949 CCCCCGTGGCCGCCCAGTTCCGG + Exonic
947544265 2:231000309-231000331 CCGCCCCAGCCTCCCAGGGCAGG + Intronic
947607249 2:231495672-231495694 CCTCCTCAGCCTCCCAGTGTTGG + Intergenic
947791269 2:232870730-232870752 CCCCAGCTGCCTCCCAGACCTGG - Intronic
948179964 2:235972024-235972046 CCACCTCAGCCTCCCAGTGCTGG + Intronic
948206738 2:236166699-236166721 CCCCCGCACCCTCCCAGCCTCGG + Intronic
948473713 2:238203390-238203412 CGCCCGCCGCCTCCCAGCGCGGG + Intronic
948529203 2:238593317-238593339 CCGCCTCATCCTCCCAGTGCTGG + Intergenic
1169239414 20:3962946-3962968 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1170713239 20:18810557-18810579 CCCCCGCCGCCCCCCAGTCCAGG + Intronic
1170777558 20:19390896-19390918 CCCCTGCAGCCTCAGAATTCAGG - Intronic
1170876058 20:20251353-20251375 CCCTCCCACCCTCCCAGTTGTGG + Intronic
1171459175 20:25288983-25289005 CCACAGCAGCCTCACAGTTCTGG - Intronic
1172086936 20:32392573-32392595 CCGCCTCAGCCTCCCAGCACAGG - Intronic
1172150926 20:32789839-32789861 CCGCCTCGGCCTCCCAGTGCTGG + Intronic
1172391048 20:34565505-34565527 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1172430814 20:34890004-34890026 CACCAGCAGCATCCTAGTTCAGG - Intronic
1172800682 20:37574220-37574242 CCACCGCAGCCTGCCAGGTTTGG - Intergenic
1172891452 20:38268759-38268781 GCCCTTCAGCCTCCCTGTTCTGG - Intronic
1173508429 20:43607327-43607349 GCCCGGCAGCCACCCAGTCCGGG - Intronic
1173636144 20:44559953-44559975 CCACCTCAGCCTCTCAGTTTTGG - Intronic
1173687750 20:44936083-44936105 CCACCTCAGCCTCCAAGTACAGG + Intronic
1174321698 20:49747114-49747136 TCACTGCAGCCTCCAAGTTCTGG - Intergenic
1174575568 20:51534580-51534602 CCACCTCGGCCTCCCAGTGCTGG + Intronic
1175847054 20:62064893-62064915 CCCCCGCCGCCGCCCAGAACGGG - Exonic
1175989367 20:62780037-62780059 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1176230711 20:64031425-64031447 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1176722237 21:10402177-10402199 CCCCTGCAGCCTCTCTGGTCCGG + Intergenic
1177349210 21:19913152-19913174 CCACCTCAGCCTCCCAGTGGTGG - Intergenic
1178417086 21:32412722-32412744 CCCCCGCCGCCTCCCTGCCCAGG - Exonic
1179362763 21:40727921-40727943 CCCCTGCAGGCTCCCACCTCTGG + Intronic
1180213581 21:46311117-46311139 CCGCCTCAGCCTCCCAGTGTTGG + Intronic
1180303422 22:11054939-11054961 CCCCTGCAGCCTCTCTGGTCCGG + Intergenic
1180665377 22:17506726-17506748 CCCCCGCAGCCTCCACCTCCTGG + Intronic
1182485196 22:30635172-30635194 CCTCCCCAGCCTCCCAGTCCAGG - Intergenic
1182638694 22:31749962-31749984 CGCCCGAAGCCTTCCAGTCCCGG + Intronic
1183332767 22:37230234-37230256 CCCCAGGGCCCTCCCAGTTCCGG + Intronic
1183450199 22:37889849-37889871 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
1183461123 22:37951301-37951323 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1183699243 22:39440961-39440983 CAACCTCAGCCTCCCAGTGCTGG - Intergenic
1184733658 22:46385342-46385364 CCATCTCAGCCTCCCAGTGCTGG + Intronic
1184818536 22:46891013-46891035 CGTCCGCAGCCTCCCGGTGCAGG - Intronic
949989892 3:9570127-9570149 GCCCCGCAGCCGCCCCGTCCGGG + Intergenic
950348719 3:12325171-12325193 CCACCTCAGCCTCCCAGTGTTGG - Intronic
950496147 3:13335696-13335718 ACCCCCCAGCCCCCCAGTCCTGG + Intronic
951045254 3:18030654-18030676 CCCCCTCAGCCTCCAAATGCTGG - Intronic
952367245 3:32685539-32685561 GCCCCGCCGCCTCCGAGTTCAGG - Intronic
952894015 3:38064653-38064675 GCCCCGCAGCCACCCCGTCCGGG - Intronic
953332780 3:42068045-42068067 CCGCCTCAGCCTCCCATTACAGG - Intronic
953652759 3:44821321-44821343 GCCCCGCAGCCACCCCGTCCAGG - Intronic
953897299 3:46812262-46812284 CCCCAGCGGCCCCCCAGTCCAGG - Exonic
954028007 3:47798390-47798412 CCGCCTCAGCCTCCCAGTGCCGG + Intergenic
954058052 3:48044513-48044535 CCACCTCGGCCTCCCAGTGCTGG - Intronic
954060334 3:48061720-48061742 ACCCGGCAGCCGCCCAGTCCGGG + Intronic
954185348 3:48912796-48912818 CCGCCTCAGCCTCCCAGTGCTGG - Intergenic
954314541 3:49794052-49794074 CCTCCTCAGACCCCCAGTTCAGG - Intronic
954383870 3:50234304-50234326 CCGCCTCGGCCTCCCAGTACTGG + Intronic
954826242 3:53375973-53375995 CCACCTCAGCCTCCCAAGTCTGG - Intergenic
956136204 3:66101458-66101480 CCTCCTCAGCCTCCCAGTGTTGG - Intergenic
956671715 3:71697561-71697583 CCCCCACAACTTCCCAGCTCTGG + Intronic
956822099 3:72963323-72963345 CCGCCTCAGCCTCCCAGTGCTGG - Intronic
956858718 3:73301430-73301452 CCACCTGAGCCTCCCAGTGCTGG + Intergenic
957182855 3:76903550-76903572 CCCCCACACCATCCCAGTACTGG + Intronic
957226953 3:77461838-77461860 CTGCCGCAGCCTCCCATATCTGG + Intronic
958193230 3:90210126-90210148 CTGCCTCAGCCTCCCAGTTCTGG - Intergenic
958416533 3:93881073-93881095 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
959071741 3:101707823-101707845 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
961247471 3:125467867-125467889 ACCCAGCAGTCTCCCAGTACTGG + Intronic
961760794 3:129166026-129166048 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
961949028 3:130727345-130727367 CTCCCGCCGCCTCCGAGTACAGG + Intronic
963202777 3:142601640-142601662 CCGCCTCAGCCTCCCAGGTGTGG + Intronic
963249071 3:143086745-143086767 GCCCCGCAGCCACCCCGTCCGGG - Intergenic
964123189 3:153207555-153207577 CCGCCTCAGCCTCCCAGTGTTGG + Intergenic
966206676 3:177412893-177412915 ACCCGGCAGCCACCCAGTCCGGG - Intergenic
966276185 3:178172871-178172893 CCACCTCAGCCTCCCAGTGCTGG - Intergenic
966376441 3:179300789-179300811 CCGCCTCAGCCTCCCAGTGTTGG + Intergenic
967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG + Intergenic
968514856 4:1011733-1011755 CCCCCGCCGCCTGCCCGGTCCGG + Intronic
969354047 4:6614722-6614744 CCCACTCATCCTCCAAGTTCAGG + Intronic
972629503 4:40831148-40831170 CCACCTCGGCCTCCCAGTGCTGG - Intronic
974109477 4:57510583-57510605 CCTCCGCTGCCTCCAAGTTGGGG - Intergenic
974788681 4:66656909-66656931 TCGCCTCAGCCTCCCAGTTTTGG - Intergenic
975570840 4:75816210-75816232 CTGCCTCAGCCTCCCAGTGCTGG + Intergenic
975949073 4:79746296-79746318 ACCCAGCAGCCTCCTAGCTCTGG + Intergenic
976278648 4:83304576-83304598 CCACCTCAGCCTCCCAGTGTTGG - Intronic
976782398 4:88775454-88775476 CCACCTCAGCCTCCCAGTGCTGG - Intronic
977799358 4:101207577-101207599 CCACCTCGGCCTCCCAGTGCTGG - Intronic
978013737 4:103719463-103719485 CCCCCGCGCCCTCCCAGCCCTGG - Exonic
978141338 4:105320685-105320707 CCACCTCGGCCTCCCAGTGCTGG + Intergenic
978441838 4:108741463-108741485 CCGCCTCAGCCTCCTAGTGCTGG - Intergenic
978443485 4:108758801-108758823 CCGCCTCGGCCTCCCAGTGCTGG - Intronic
978683675 4:111414486-111414508 CCTCTGCTGCCTCCAAGTTCGGG - Intergenic
978947537 4:114516700-114516722 GCCCCGCAGCCACCCTGTCCGGG + Intergenic
980948430 4:139347029-139347051 CACCCCCAGCCTCCCACTACAGG + Intronic
981413910 4:144465378-144465400 CACACGCAGCTTCCCAATTCTGG - Intergenic
981468088 4:145097119-145097141 CAACCTCCGCCTCCCAGTTCAGG - Intronic
981705498 4:147655235-147655257 CCCCTGCAGCCTCCAACTCCTGG + Intronic
981751409 4:148095695-148095717 CCCATGCAGCCTCCCAGGGCTGG + Intronic
981994872 4:150964059-150964081 GCCCGGCAGCCTCCCCGTCCGGG + Intronic
982833290 4:160090069-160090091 CCACCTTGGCCTCCCAGTTCTGG - Intergenic
983536250 4:168860322-168860344 CCCCCTCGGACTCCCAGGTCTGG + Intronic
984369394 4:178842825-178842847 CCACCTCAGCCTCCCAGGTTGGG + Intergenic
985607989 5:868940-868962 CACCGGCAGCCTCCCAGGTGAGG + Intronic
986705843 5:10454237-10454259 CCACCTCAGCCTCCCAAGTCGGG + Intronic
986749815 5:10776835-10776857 TCCCACCAGCCTCCCAGTCCAGG + Intergenic
988075167 5:26342972-26342994 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
988674018 5:33412669-33412691 CCTCCCCAGCCTCCCAATTGTGG + Intergenic
988819075 5:34862890-34862912 TCCCCCAGGCCTCCCAGTTCAGG + Exonic
991068891 5:62455270-62455292 CCACCACGGCCTCCCAGTGCTGG - Intronic
991379801 5:66008167-66008189 CCACCTCAGCCTCCCAGTGTTGG - Intronic
991564257 5:67988295-67988317 CCACCTCTGCCTCCCAGCTCAGG - Intergenic
991949619 5:71934654-71934676 CAGCCTCTGCCTCCCAGTTCAGG + Intergenic
992129122 5:73673922-73673944 CCACCTCAGCCTCCCAGTGTTGG - Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
992663501 5:78984581-78984603 CCTCCCCAGCCTCCCACCTCAGG + Intronic
995505105 5:112851891-112851913 CCTCCTCAGCCTCCCATTCCTGG - Intronic
996173395 5:120324196-120324218 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
997739921 5:136244276-136244298 CCACCTCAGCCTCCCAGTGTTGG + Intronic
998142106 5:139705851-139705873 CCCAGGCAGGCTCCCAGATCGGG + Intergenic
998714687 5:144869449-144869471 CTACCGCAGCCTCCCAATGCCGG - Intergenic
999243935 5:150143511-150143533 CCCCCACAGACTCCCAGGCCTGG - Intronic
999414139 5:151380235-151380257 CCGCCGCAGCCTCCCACCTAGGG - Intergenic
999455634 5:151714043-151714065 GCCCCGCAGCCGCCCCGTCCGGG - Intergenic
999734271 5:154500963-154500985 CCACCTCGGCCTCCCAGTGCTGG - Intergenic
1001035266 5:168292344-168292366 CCCCTGCCCCCTCCCAGTCCCGG - Intronic
1001541200 5:172540988-172541010 CCCTCCCGCCCTCCCAGTTCAGG - Intergenic
1001607641 5:172973945-172973967 CCACCTCAGCCTCCCAGAACTGG + Intergenic
1002027852 5:176407549-176407571 CCACCTCAGCCTCCCACTGCTGG + Intronic
1002124283 5:177030369-177030391 CCGCCTCGGCCTCCCAGTGCTGG - Intronic
1002172099 5:177380927-177380949 CCACCTCAGCCTCCAAGTGCTGG + Intronic
1002206145 5:177563926-177563948 CCCCCGCAGCCCCTGAGTTGTGG + Intergenic
1002436965 5:179237595-179237617 CTCCCCCAGCCTCCCAGAGCTGG - Intronic
1002494235 5:179600943-179600965 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1002525948 5:179816393-179816415 CCACCTCGGCCTCCCAGTGCTGG + Intronic
1002949015 6:1789785-1789807 CCACCTCAGCCTCCCAGTGATGG + Intronic
1003360091 6:5417289-5417311 CCACTGCAGCCTCCAAGTCCTGG + Intronic
1003678043 6:8225194-8225216 CCACCTCAGCCTCCCATTGCTGG + Intergenic
1004637885 6:17486354-17486376 CCGCCTTAGCCTCCCAGTGCTGG - Intronic
1005859483 6:29889504-29889526 CCACCACAGCCGCCCACTTCTGG - Intergenic
1005867047 6:29944297-29944319 CCACCACAGCCGCCCACTTCTGG - Exonic
1006316042 6:33292358-33292380 CCCCCACAGCCGCCCAGATGTGG + Intronic
1006803938 6:36776659-36776681 CCTCTGCAGCCTCCCATCTCTGG + Intronic
1006820288 6:36887970-36887992 CCACCTCAGCCTCCCAGTGTTGG + Intronic
1007460487 6:42014673-42014695 CAACCTCAGCCTCCCAGTGCTGG - Intronic
1007544991 6:42686761-42686783 GCCCAGCAGCCGCCCAGTCCGGG - Intronic
1007722282 6:43892058-43892080 CCGCCTCAGCCTCCCAGTGTTGG - Intergenic
1007749174 6:44061634-44061656 CCAGCACAGCCTCCAAGTTCTGG + Intergenic
1008211515 6:48729920-48729942 CCTCTGCTGCCTCCAAGTTCAGG + Intergenic
1008919250 6:56824844-56824866 GCCCCGCAGCCACCCCGTCCGGG + Intronic
1010212600 6:73373941-73373963 CCGCCTCAGCCTCCCAGTGATGG - Intronic
1010227898 6:73508151-73508173 CCCCTACAGCCTCCAAATTCTGG - Intronic
1010400593 6:75441951-75441973 GCCCCGCAGCCACCCCGTCCGGG - Intronic
1010795896 6:80115881-80115903 CCCCCTCGGCCTCCCAATGCTGG + Intronic
1012548761 6:100449130-100449152 CCCCCGCGGCCACCCAGTATTGG + Intronic
1014463661 6:121729716-121729738 ACCCAGCAGCCTCCCTGTCCGGG - Intergenic
1014757077 6:125313179-125313201 CCACCTCGGCCTCCCAGTGCTGG - Intergenic
1015400240 6:132780344-132780366 CCACCTCAGCCTCCCACTTATGG + Intronic
1015983614 6:138863859-138863881 CCGCCTCAGCCTCCCAGTGTTGG + Intronic
1015986308 6:138887471-138887493 CCGCCTCGGCCTCCCAGTGCTGG + Intronic
1016746911 6:147590658-147590680 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1017307456 6:152935683-152935705 CCTCCTCAGCCTCCCAGTGCTGG + Intergenic
1017652844 6:156599043-156599065 GCCCCGCAGCCTCTCGGCTCCGG + Intergenic
1017719850 6:157236540-157236562 CCCCCGCGGGCTCCTAGCTCGGG - Intergenic
1018232895 6:161692655-161692677 CCCCCTCAGCCTCCCAGTGCTGG - Intronic
1018242885 6:161795479-161795501 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1019426867 7:982149-982171 CCGCCGCAGCCGCCCAGCCCTGG + Intergenic
1019654815 7:2185841-2185863 CACCCCCAGCCTACCTGTTCAGG + Intronic
1019725644 7:2601019-2601041 CAGCCTCAGCCTCCGAGTTCTGG + Intronic
1019965318 7:4494095-4494117 CCACCTCGGCCTCCCAGTGCTGG + Intergenic
1020303880 7:6817763-6817785 CCACCTCGGCCTCCCAGTGCTGG - Intronic
1020512296 7:9073082-9073104 CTACCTCAGCCTCCCAGTGCTGG + Intergenic
1022100104 7:27164463-27164485 CTCCCCCAGCGTCCCAGCTCCGG + Intronic
1022318114 7:29263902-29263924 GCCCGGCAGCCTCCCTGTCCGGG + Intronic
1023286854 7:38630046-38630068 CTCAGGCTGCCTCCCAGTTCCGG - Intronic
1024360507 7:48462794-48462816 CCACCGCATCCTGCCAGTTCAGG + Intronic
1025257670 7:57396406-57396428 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
1025619633 7:63156897-63156919 CCGCCTCAGCCTCCCAGTGTTGG - Intergenic
1025729545 7:64097841-64097863 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1026002202 7:66569398-66569420 CCACTGCAGCCTCAAAGTTCTGG - Intergenic
1026121793 7:67544119-67544141 CAACCTCCGCCTCCCAGTTCAGG - Intergenic
1026194684 7:68162841-68162863 CACCCCCCGCCTCCCAGTTTGGG + Intergenic
1026578882 7:71597431-71597453 TCCCTGCAGCCTCCAACTTCTGG - Intronic
1026580800 7:71615120-71615142 CCCCAGCAGCCTCCCAGTCAGGG - Intronic
1026884096 7:73927865-73927887 CCACCTCGGCCTCCCAGTGCTGG + Intergenic
1028541280 7:91945111-91945133 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1028996412 7:97105181-97105203 CCGCCTCAGCCTCCCAGTGTTGG - Intergenic
1029411926 7:100418541-100418563 CCACCTCAGCCTCTCAGTGCTGG - Intronic
1029498577 7:100912643-100912665 CCACCTCAGCCTCCCAATGCTGG - Intergenic
1032260897 7:130336197-130336219 CCGCCTCAGCCTCCCAGTGTTGG - Intergenic
1032626691 7:133598732-133598754 CCGCTTCAGCCTCCCAGTGCTGG - Intronic
1033208944 7:139446088-139446110 CCGCCTCGGCCTCCCAGTGCTGG + Intergenic
1033601888 7:142894338-142894360 TCCTCTCAGCCTCCCAGCTCAGG - Intergenic
1033790043 7:144780417-144780439 CCCCAGCCGCATCCCAGTACTGG + Intronic
1034170771 7:149061366-149061388 CCGGCTCAGCCTCCCAATTCTGG - Intergenic
1034193223 7:149226558-149226580 CCGCCTCGGCCTCCCAGTGCTGG - Intergenic
1035223674 7:157421883-157421905 CCGCCTCGGCCTCCCAGTGCTGG + Intergenic
1035324607 7:158056826-158056848 CCCACGCATCATCCCAGGTCAGG + Intronic
1035737476 8:1898822-1898844 GCCCCGCGGCCCCCCAGTGCTGG - Intronic
1036578831 8:10054406-10054428 CCCCTGCCGCCCCCCGGTTCCGG + Exonic
1037261130 8:17009645-17009667 CCACCTCAGCCTCCAAGTCCTGG - Intergenic
1037608443 8:20456835-20456857 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1037625778 8:20605638-20605660 CCCTGGCAGCCTCCCCGTTCAGG + Intergenic
1037963435 8:23116431-23116453 GCCCCTCAGCCTCCCTGCTCTGG - Intronic
1038325599 8:26570489-26570511 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1038540142 8:28385236-28385258 CCGCCGCCGCCTCCCGGTTTTGG - Intronic
1038540951 8:28389637-28389659 CCACTGCAGCCTCCAACTTCTGG - Intronic
1039444940 8:37623445-37623467 CCGCCTCAGCCTCCCAGTGTTGG - Intergenic
1039652039 8:39352699-39352721 CCACAGCAGCCTCCCACTCCTGG - Intergenic
1041675775 8:60537925-60537947 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1042238811 8:66641472-66641494 CCACCTCAGCCTCCCAGTGCTGG + Intronic
1042796151 8:72665362-72665384 CCCCAGCAGTTTCCCACTTCAGG - Intronic
1042829955 8:73016003-73016025 CCACCTCAGCCTCCCAGAGCTGG - Intronic
1045163823 8:99580600-99580622 CCACCTCAGCCTCCCAGTGTTGG - Intronic
1046711992 8:117520798-117520820 GCCCCACAGCCTCCCAATTCCGG + Exonic
1047270112 8:123349787-123349809 CCACCTCAGCCCCCAAGTTCTGG - Intronic
1049079298 8:140429335-140429357 CCACCGTGGCCTCCCAGTGCTGG + Intronic
1049116043 8:140688465-140688487 CCACCTCAGCCTCCCAGATAAGG - Intronic
1049837609 8:144748319-144748341 CCGCCTCGGCCTCCCAGTGCTGG + Intronic
1053344150 9:37365586-37365608 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1053392635 9:37746577-37746599 TCCCCGCTGCCTCCCTGTGCCGG - Exonic
1057237767 9:93378752-93378774 CAACCTCTGCCTCCCAGTTCAGG - Intergenic
1057483876 9:95466936-95466958 CTGCAGCAGCCTCCCAGATCTGG - Intronic
1057600728 9:96454865-96454887 CCCGCCTAGCCTCCCAGTGCTGG - Intronic
1057610331 9:96537175-96537197 CCACCTCAGCCTCCCAGTAACGG - Intronic
1058244676 9:102607801-102607823 CCCCCTCGGCCTCCCAGTGTTGG + Intergenic
1058862159 9:109126975-109126997 CCGCCTCAGCCTCCCAGTGCTGG - Intergenic
1059320617 9:113465627-113465649 CCTCCTCAGCTTCCCAGATCTGG - Intronic
1059437572 9:114285749-114285771 CCCTCGCAGCCTGCCAGGGCTGG + Intronic
1059518580 9:114918680-114918702 CAACCTCCGCCTCCCAGTTCAGG + Intronic
1059777399 9:117489168-117489190 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
1060600384 9:124873514-124873536 GCCCTGCAGCCTCCCTGTGCAGG + Intronic
1060924834 9:127449072-127449094 CCGCCTCAGCCTCCCAGTGCTGG + Intronic
1061156028 9:128862248-128862270 CTGCCGCAGCGTCCCAGTGCTGG + Intronic
1062006746 9:134242279-134242301 CCCTCCCACCCTCCCAGTCCCGG + Intergenic
1062329423 9:136030908-136030930 CCACCTCAGCCTCGCAGTGCTGG + Intronic
1062346037 9:136115784-136115806 CCTCAGCAGGCTCCCAGCTCAGG - Exonic
1062347006 9:136119457-136119479 CCCCCGCCGCCCCCCAGTGAAGG + Intergenic
1062405646 9:136394991-136395013 CCCCCACAGCCTCACAGTACGGG - Intronic
1062572325 9:137191382-137191404 CCACCCCAGCCTCCCAGAGCTGG - Intergenic
1185583611 X:1229029-1229051 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1185907457 X:3949274-3949296 CAACCTCAGCCTCCCAGTGCTGG + Intergenic
1187191143 X:17036572-17036594 CCCCAGCTGCTTCCCAGTTCTGG + Intronic
1189007498 X:37010337-37010359 CGCCCGGAGCCTCCCAATACTGG + Exonic
1189263596 X:39696061-39696083 CCCCCTCAGCCTCCCAGTGTTGG + Intergenic
1189321544 X:40090429-40090451 CCCCGGCCCCCACCCAGTTCGGG + Intronic
1189413982 X:40798181-40798203 CCACCTCAGCCTCCCAGTGTTGG - Intergenic
1191244321 X:58213964-58213986 CCACCTCAGCCTCCCAGTGCTGG + Intergenic
1192122771 X:68472827-68472849 CCACCTCGGCCTCCCAGTGCTGG - Intergenic
1192126631 X:68506822-68506844 CACCCGCAGCCTTCAACTTCTGG + Intronic
1192409863 X:70924510-70924532 CCACCTCAGCCTCCCAGTGTTGG + Intergenic
1192427492 X:71090298-71090320 CCGTCTCAGCCTCCCAGTTCTGG - Intergenic
1192774061 X:74223532-74223554 CCACCTCAGCCTCCAAGTGCTGG + Intergenic
1194611579 X:96051161-96051183 GCCCGGCAGCCACCCAGTCCGGG - Intergenic
1194840710 X:98737810-98737832 TCACTGCAGCCTCCCACTTCTGG + Intergenic
1196606211 X:117660325-117660347 CCACTTCAGCCTCCCAGTGCTGG + Intergenic
1196695396 X:118606314-118606336 CCGCCTCGGCCTCCCAGTGCTGG + Intronic
1196738113 X:118998780-118998802 CATCCTCTGCCTCCCAGTTCAGG + Intronic
1196778547 X:119362194-119362216 GCCCGGCAGCCACCCAGTCCGGG + Intergenic
1197199020 X:123732865-123732887 CCCCCTCAACCTCCCACTACAGG + Intronic
1198108627 X:133483848-133483870 GCCCGGCAGCCGCCCAGTCCGGG - Intergenic
1198571931 X:137966686-137966708 CCACCACATCCTCCCAGATCTGG + Intergenic
1199771174 X:150976232-150976254 CCCCGGCAGCCTCCGGGGTCTGG + Intergenic
1199798663 X:151227892-151227914 TCCCTGCTGCCTCCCAGCTCGGG + Intergenic
1199836747 X:151599462-151599484 GCCCGGCAGCCGCCCAGTCCGGG - Intronic
1200227468 X:154426828-154426850 CCGCCTCAGCCTCCCAGTGTTGG + Intergenic
1202303922 Y:23447606-23447628 CCGCCTCAGCCTCCCAGTGCTGG + Intergenic
1202566888 Y:26222985-26223007 CCGCCTCAGCCTCCCAGTGCTGG - Intergenic