ID: 1099072239

View in Genome Browser
Species Human (GRCh38)
Location 12:78059581-78059603
Sequence AAAAATATCCCCAAATAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 461}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099072239_1099072243 4 Left 1099072239 12:78059581-78059603 CCCGCCTATTTGGGGATATTTTT 0: 1
1: 0
2: 5
3: 40
4: 461
Right 1099072243 12:78059608-78059630 CTAGGATGATTTTCTTTACAAGG 0: 1
1: 0
2: 2
3: 12
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099072239 Original CRISPR AAAAATATCCCCAAATAGGC GGG (reversed) Intronic
902055540 1:13597812-13597834 AAAAATAAACCCAATTAGCCAGG + Intronic
903076092 1:20767989-20768011 AAAAATGTCCCAAAAAAGGAAGG + Intronic
904453960 1:30635826-30635848 CAACAGATCCCCAAAGAGGCCGG + Intergenic
905090808 1:35429930-35429952 AAAAAAATCCCCAAAGATGCAGG - Intergenic
906015369 1:42572912-42572934 AGAAATATGCCACAATAGGCTGG - Intronic
906224654 1:44111500-44111522 AAAATTATTCCCAAATAAGAAGG - Intergenic
906636704 1:47415260-47415282 AGAAGTTTCCCAAAATAGGCTGG + Intergenic
907170369 1:52457528-52457550 AAGAAAATCACAAAATAGGCTGG - Intronic
907220423 1:52903388-52903410 AAAAAAATCCTCAAATAGCATGG - Intronic
908825484 1:68129027-68129049 AAAAATATCCGCATACAGCCGGG + Intronic
909018927 1:70410274-70410296 AGAAATATCCCCAAATTTCCTGG + Intergenic
909156151 1:72078934-72078956 TAAAATATCAATAAATAGGCTGG - Intronic
909650865 1:77974426-77974448 AAAAATACCAAAAAATAGGCTGG - Intronic
909674512 1:78224222-78224244 AAAAATGTTCCCAAATACACTGG - Intergenic
909796739 1:79748795-79748817 ATAAAAATCCCCAGACAGGCTGG - Intergenic
909849748 1:80445780-80445802 AAAAATATACCCTTATAGGTGGG + Intergenic
911451927 1:98073687-98073709 AAAAATATCAAAAAAGAGGCAGG + Intergenic
912335043 1:108854116-108854138 AGGAATATCCCCAAAGAGTCTGG - Intronic
912621575 1:111164915-111164937 AAAAATAACCTAATATAGGCCGG - Intronic
913140241 1:115934090-115934112 AAAAAAATCACAAAAAAGGCTGG + Intergenic
913187299 1:116380521-116380543 GAAATTATCCCAAAATAAGCAGG - Intronic
913253581 1:116933674-116933696 AAAAAAATCCTCAAATAGGAAGG - Intronic
913673792 1:121122566-121122588 AAAAATATGCATATATAGGCCGG - Intergenic
914025570 1:143909918-143909940 AAAAATATGCATATATAGGCCGG - Intergenic
914664007 1:149817643-149817665 AAAAATATGCATATATAGGCCGG - Intergenic
914671758 1:149876200-149876222 AAAAATATGCATATATAGGCGGG + Intronic
914792942 1:150895308-150895330 AAAGATTTCCCCAAACAGGAAGG - Intergenic
916456144 1:164972702-164972724 AAAAATATATCCAAATAGAAGGG - Intergenic
916928427 1:169548570-169548592 TAAAATATCCCAAAAGAGCCGGG + Intronic
917575985 1:176322342-176322364 AAAATTATCACCAAATACTCAGG + Intergenic
917823449 1:178790492-178790514 AAAAATATAACTAAATAGACAGG - Intronic
919895158 1:202005039-202005061 CAGAATATCCCCGAACAGGCAGG - Intronic
920154485 1:203937455-203937477 AAAAATACCCCAAAATTAGCTGG + Intergenic
920689664 1:208136282-208136304 AAAAATATCCCCAAACCTGGGGG + Intronic
921451518 1:215313297-215313319 TCAAATATTCCCAAAAAGGCAGG - Intergenic
921809966 1:219501616-219501638 TAAAATATGCCTAAAGAGGCAGG - Intergenic
922600745 1:226850621-226850643 TAGAAAATACCCAAATAGGCTGG - Intergenic
924588298 1:245379304-245379326 AGAAAGATCCCCAAATATGGGGG - Intronic
1062866364 10:858853-858875 AAAAAAATCAGAAAATAGGCTGG + Intronic
1064125488 10:12656328-12656350 AAAAATATGCCAAAATTAGCTGG + Intronic
1064425128 10:15223600-15223622 AAAAATAGCTCCACATTGGCTGG + Intronic
1064434206 10:15296728-15296750 AAAAAGAACCCCACATAGGTGGG - Intronic
1064665797 10:17649908-17649930 TAAAATATTACCAAATTGGCTGG - Intronic
1065916678 10:30358968-30358990 ATAAATATCTATAAATAGGCCGG + Intronic
1065991315 10:31013021-31013043 ATAAAAATCCCCAACTGGGCCGG + Intronic
1067317106 10:45179148-45179170 AAAAATATCACCAAATATATTGG - Intergenic
1067495966 10:46760311-46760333 AAAAAAATACACAAATTGGCTGG + Intergenic
1067531501 10:47077460-47077482 ACAAATATCCACAAATTGGGTGG + Intergenic
1067598690 10:47580078-47580100 AAAAAAATACACAAATTGGCTGG - Intergenic
1068205699 10:53849566-53849588 AAAAATATGTACAAATTGGCCGG + Intronic
1068248048 10:54398744-54398766 AAAAAAAACCCCAAATATTCTGG + Intronic
1068689197 10:59898741-59898763 AAATATAGCCTCAAAGAGGCAGG - Intronic
1069023267 10:63513614-63513636 AAAAATAGTCCCATTTAGGCCGG + Intergenic
1069674366 10:70236969-70236991 AAAAATATACAAAAATAAGCTGG + Intergenic
1070176408 10:73973901-73973923 AAAAATATTCCAAAATTGGCTGG + Intergenic
1070361474 10:75694086-75694108 AAAATTAACCAGAAATAGGCAGG + Intronic
1070480017 10:76872975-76872997 AAAAATATGCCAAAAGAGGAAGG + Intronic
1071612438 10:87043817-87043839 CAAAAAAACCCCAAACAGGCCGG + Intergenic
1073620328 10:105040277-105040299 AGAAATATCCACAAATAGATGGG + Intronic
1074057072 10:109932181-109932203 AAAAATGTCCTAAAATTGGCTGG - Intergenic
1074411285 10:113230700-113230722 AAAAAACTCCCCAGATAGGACGG + Intergenic
1075041209 10:119108186-119108208 AAAAAAACCCCAAAATAGGCTGG + Intronic
1076213245 10:128669736-128669758 AAACATATTCCAAAATAGGGTGG + Intergenic
1077395548 11:2319038-2319060 CAAAATATAAACAAATAGGCGGG + Intergenic
1078037542 11:7823372-7823394 ACAAGGATCACCAAATAGGCCGG + Intergenic
1078096923 11:8304232-8304254 AAAAAAACCCCAAAATAGCCAGG + Intergenic
1078989279 11:16629636-16629658 AAAACTATCCCCAAAAATGGAGG - Intronic
1079147340 11:17865412-17865434 AAAAATACCTCCTAAAAGGCAGG + Intronic
1079669250 11:23146071-23146093 GAACATATCCCTAAATAGCCAGG + Intergenic
1080531887 11:33184401-33184423 AGAAATATATACAAATAGGCCGG - Intergenic
1080604774 11:33855912-33855934 TCAAATATCCCCAAATAATCTGG + Intergenic
1081422428 11:42885989-42886011 AAAAATAGCAAGAAATAGGCTGG + Intergenic
1082082204 11:48020943-48020965 AGAAAGATCCCCAAAAGGGCAGG + Intronic
1083602418 11:63957087-63957109 AAAAATAACCTGAAATAGGGTGG - Exonic
1084932494 11:72568401-72568423 AAAAAAATACCCAAATTGGCTGG - Intergenic
1085595065 11:77801867-77801889 AAAAAAATCCCTAAACTGGCTGG + Intronic
1086479923 11:87223555-87223577 AAAAAAAACCCCAAAAAGTCTGG + Intronic
1086647465 11:89242367-89242389 AAAAAAATGCCCAAATTAGCTGG - Intronic
1086699700 11:89887020-89887042 AAAAATATCACAAAGTAGGAAGG - Intergenic
1086706471 11:89957496-89957518 AAAAATATCACAAAGTAGGAAGG + Intergenic
1086937129 11:92757218-92757240 AAAAGGAGCCACAAATAGGCCGG - Intronic
1086942104 11:92809102-92809124 AAAAATATCTCCACAAAAGCTGG + Intronic
1087557388 11:99738562-99738584 AAAAATAACCCAGAAAAGGCAGG + Intronic
1089155086 11:116395688-116395710 ATAAATATTCCCATACAGGCTGG - Intergenic
1089992541 11:122875207-122875229 AAAAATATGTCCACACAGGCGGG + Intergenic
1090683586 11:129089113-129089135 AAAAATATCCCAACATATGTAGG + Intronic
1092127217 12:6083402-6083424 AAAAATATCCAAAATTAGCCAGG + Intronic
1093393765 12:18655274-18655296 AAAAATATTCCCAAAGACACAGG + Intergenic
1093590994 12:20902770-20902792 AAAAATCTCCAAAAACAGGCCGG + Intronic
1094165849 12:27442780-27442802 AAAAAAATCCAAAAATTGGCTGG - Intergenic
1094630206 12:32166429-32166451 AAAAATGTCTCCAGATAGCCTGG - Intronic
1096069212 12:48765523-48765545 AAAAATAGCTCCCAAGAGGCTGG - Intergenic
1096273239 12:50183515-50183537 AAAAAAAATCCAAAATAGGCTGG + Intronic
1096276052 12:50209117-50209139 AAAAATAGACCCAATCAGGCCGG - Intronic
1096449781 12:51728747-51728769 AAAAAAATTCCCAAATGGCCAGG + Intronic
1096468065 12:51858967-51858989 AAAGATTACCCCAAATCGGCTGG + Intergenic
1096734204 12:53639930-53639952 AAAAAAAGAACCAAATAGGCCGG - Intronic
1097443344 12:59638592-59638614 AAAAATTACACCAAATAGACTGG - Intronic
1097995892 12:65887559-65887581 AAAAATATACAAAAATTGGCTGG + Intronic
1098897573 12:76081636-76081658 AAAAATATATACAAATATGCAGG + Intronic
1099072239 12:78059581-78059603 AAAAATATCCCCAAATAGGCGGG - Intronic
1099874837 12:88391811-88391833 AAAAAAATCCCCAAGCAGCCAGG - Intergenic
1100903759 12:99273879-99273901 AAAAAAATCACAAAAAAGGCCGG - Intronic
1101142806 12:101813317-101813339 CAAACTATCCCCAAATTTGCTGG - Intronic
1101256495 12:102982629-102982651 AAAAATATGAGTAAATAGGCTGG - Intergenic
1102140637 12:110612122-110612144 AAAAATAACCAAAAGTAGGCCGG - Intergenic
1102152885 12:110700752-110700774 ATAAATATCTCCAAGTAGACCGG - Intronic
1103291044 12:119846605-119846627 TAAAATATCTAAAAATAGGCTGG + Intronic
1103417616 12:120754130-120754152 AAAAATATATACAAATGGGCTGG - Intergenic
1103635327 12:122299959-122299981 AGAAATAACCACAACTAGGCTGG + Intronic
1103672920 12:122632984-122633006 AAAAATATCCCCAGGTGGGCCGG - Intergenic
1104608943 12:130212160-130212182 TAAAATATTCCATAATAGGCTGG - Intergenic
1104838320 12:131807120-131807142 AAAAATATTCTAAAACAGGCTGG + Intergenic
1105798058 13:23877143-23877165 ATAAATATGCCAGAATAGGCAGG - Intronic
1105983040 13:25538294-25538316 GAAAAAAACCCCAAATAGCCAGG - Intronic
1106082662 13:26513183-26513205 TAAAAAATACCCAAACAGGCTGG - Intergenic
1106115038 13:26810409-26810431 CAAAAACTCCCCAAATAGGAGGG - Intergenic
1106266141 13:28112003-28112025 AAAAATATCCCAATTGAGGCTGG - Intergenic
1106721486 13:32439714-32439736 AAAAATTACAACAAATAGGCTGG + Intronic
1106764989 13:32904696-32904718 AAAATTATCTCTAAATATGCTGG - Intergenic
1107110996 13:36698165-36698187 AAAAATATCCAGAAATACTCTGG - Intergenic
1107214743 13:37903221-37903243 TAAAATATCACCAAATTTGCAGG + Intergenic
1108562800 13:51662998-51663020 AACAAAATCCCTAGATAGGCTGG + Intronic
1108745010 13:53384418-53384440 ACAAATAACCCCAAATATGGTGG + Intergenic
1109141993 13:58724583-58724605 AAGACTATCCACAAATAGGAAGG + Intergenic
1110331231 13:74275664-74275686 AAAAATACCCAAAAAGAGGCAGG - Intergenic
1110411834 13:75212823-75212845 AAATATATCCCCAAAGACTCTGG - Intergenic
1110857317 13:80310804-80310826 AAAAATAATAACAAATAGGCCGG - Intergenic
1111037006 13:82688890-82688912 AAAAAAATCCCTAATTAGGTGGG - Intergenic
1114045083 14:18868152-18868174 AAAAAAAAAGCCAAATAGGCTGG + Intergenic
1114119128 14:19651316-19651338 AAAAAAAAAGCCAAATAGGCTGG - Intergenic
1114366409 14:22032064-22032086 TAAAATAAGACCAAATAGGCAGG + Intergenic
1114561118 14:23591176-23591198 CAAAATAGCTCCAAGTAGGCCGG - Intergenic
1115071428 14:29327506-29327528 GAAACTATCCCAAAATATGCTGG + Intergenic
1115220118 14:31050354-31050376 AAAAAAATAAACAAATAGGCCGG - Intronic
1115312788 14:31996110-31996132 AAAAAAAACCACAAAGAGGCCGG - Intergenic
1116648501 14:47560365-47560387 TAAAAAATCCTAAAATAGGCTGG - Intronic
1117146252 14:52839371-52839393 GAAAATATTCACAAATTGGCTGG - Intergenic
1118011890 14:61618012-61618034 AAAACTATCCCCAAACTGGATGG - Intronic
1118116699 14:62785894-62785916 AAAAATTTCCACAGTTAGGCAGG + Intronic
1119343306 14:73899897-73899919 TAAAATCACCCCAAATAGGCTGG + Intronic
1119554682 14:75543928-75543950 AAAATTTGCCCTAAATAGGCTGG - Intronic
1119636950 14:76281022-76281044 AAAAAGAACCCAAATTAGGCTGG + Intergenic
1120303905 14:82742991-82743013 AAACATATCTCCAACTCGGCCGG - Intergenic
1121468420 14:94130953-94130975 AAAAAAAACACCAAAAAGGCAGG - Intergenic
1123112375 14:105879179-105879201 AAGAATATTGACAAATAGGCTGG - Intergenic
1123161261 14:106280378-106280400 AAAAATACCTCAAAATAGCCTGG + Intergenic
1123587897 15:21775188-21775210 AAAAATCTCACAAAACAGGCCGG + Intergenic
1123624535 15:22217753-22217775 AAAAATCTCACAAAACAGGCCGG + Intergenic
1124919845 15:34015185-34015207 AAAAATTCCACAAAATAGGCCGG + Intronic
1124961982 15:34405494-34405516 AAAAATATACACAAATTAGCTGG - Intronic
1124978605 15:34551715-34551737 AAAAATATACACAAATTAGCTGG - Intronic
1125823576 15:42656058-42656080 AAAAAAATCCAAAAAGAGGCTGG + Intronic
1127319276 15:57826775-57826797 AAAAATATACCCAAAAAGTTGGG - Intergenic
1128828812 15:70747363-70747385 AAAAATAACCCCTAAAAGGGAGG - Intronic
1129358364 15:75007994-75008016 AAAAATAACTGCAAACAGGCCGG - Intronic
1129782795 15:78285024-78285046 AGGCATATCCCCACATAGGCTGG - Intronic
1129907049 15:79195780-79195802 CAAAGTTTCCCCAAATAGCCAGG - Intergenic
1131376950 15:91932737-91932759 AGAAATAACTGCAAATAGGCCGG - Intronic
1132801162 16:1754475-1754497 GAAACTGTCCACAAATAGGCCGG + Intronic
1133003602 16:2864830-2864852 AAAAATTTCCGCAAATATCCTGG + Intergenic
1133261457 16:4553497-4553519 AAAAATATACCAAAATTAGCTGG - Intergenic
1133437136 16:5789408-5789430 ATAAATATACACAAATATGCGGG - Intergenic
1133480395 16:6164763-6164785 TAAAATATTTCCATATAGGCTGG - Intronic
1134283291 16:12837172-12837194 AAAAATATCTACAAATTGGCTGG + Intergenic
1135345665 16:21686606-21686628 CAAAATCTCCCCAGATGGGCTGG + Intronic
1135921630 16:26654262-26654284 ATAAATAACCTAAAATAGGCCGG - Intergenic
1136023586 16:27455695-27455717 AACAACATCCCCAGATAGGAGGG - Intergenic
1136191487 16:28617858-28617880 CAAAAAATCTCCAAATGGGCTGG + Intronic
1136494743 16:30635617-30635639 AAAACTATCCCCATCCAGGCAGG + Intergenic
1138148289 16:54631719-54631741 AAAAATATGGTCAAGTAGGCAGG + Intergenic
1138664696 16:58555379-58555401 AATTATACCACCAAATAGGCAGG + Exonic
1139525594 16:67514034-67514056 AATAATATACTCAAATGGGCTGG + Intergenic
1140463211 16:75158317-75158339 AAAAATAGACAGAAATAGGCTGG - Intronic
1140523833 16:75605637-75605659 TAAAAAATCCCGAAAAAGGCTGG + Intronic
1140567712 16:76063822-76063844 AAAAATTTCCCCATATGGGCGGG + Intergenic
1141499377 16:84433081-84433103 AAAATCTTCCCCAAGTAGGCTGG + Intronic
1141642934 16:85352006-85352028 AAAAAAAAACCCAAATAGACTGG + Intergenic
1141734271 16:85841673-85841695 AAACATATCGCCAGATAGGAGGG + Intergenic
1142625251 17:1187591-1187613 TAAAATATCCTCAAATGGGCCGG + Intronic
1142874191 17:2841600-2841622 TAAAATGTCCCCAAATCGGCCGG - Intronic
1143049354 17:4111007-4111029 AAAAATATGCCGTAATTGGCTGG - Intronic
1143719898 17:8802120-8802142 AAAAAAAGCCCCAAAACGGCCGG + Intergenic
1143951104 17:10632913-10632935 TTAAATGTCCCCAAATTGGCCGG + Intronic
1144417098 17:15059627-15059649 TAGAAAATCCACAAATAGGCCGG + Intergenic
1146900910 17:36587590-36587612 AAAAAAATCCCAAATAAGGCTGG + Intronic
1146964380 17:37012347-37012369 CAAATTATCCCCAAAAGGGCCGG - Intronic
1147683351 17:42269911-42269933 AAAAATTCGCCCAAATAGGCTGG + Intronic
1147806836 17:43137888-43137910 AACAAAAACCCAAAATAGGCCGG + Intergenic
1148810077 17:50284741-50284763 AAAAAAATCCTCCAATGGGCTGG + Intergenic
1149625489 17:58077567-58077589 AAAATTATCCTCAAAAAGGCAGG + Intergenic
1150165669 17:62940246-62940268 AAAAATTTCGCCAGATGGGCTGG + Intergenic
1150682352 17:67293961-67293983 AAAAATAAAACCAAACAGGCCGG + Intergenic
1150766146 17:68003672-68003694 AAAAATAACCCTATATAGGCCGG - Intergenic
1151026120 17:70679139-70679161 AAAAATTTCACCAGATAAGCAGG - Intergenic
1151028518 17:70707201-70707223 AAAAATATATGCATATAGGCTGG - Intergenic
1151257775 17:72892587-72892609 AAAAATAACCCCAAATCAGTGGG - Intronic
1151734888 17:75933195-75933217 AGAAATCTGGCCAAATAGGCAGG + Intronic
1152422100 17:80199114-80199136 GAAAATGTCCCCAAATTAGCCGG - Intronic
1153202914 18:2664009-2664031 TAAAATATCCTGGAATAGGCCGG - Intronic
1153933156 18:9896631-9896653 AAAAATATCCTCACACAGGCTGG - Intergenic
1154343846 18:13526284-13526306 AAAAATATCCCCGGATAAGCTGG + Intronic
1154436205 18:14343425-14343447 AAAAATATCCTTAAATAGATGGG - Intergenic
1154929783 18:20981096-20981118 AGAAATATCCACAAAAGGGCCGG + Intronic
1155465883 18:26134657-26134679 AAAAATATCCCAAAATTGCTGGG + Intronic
1155482306 18:26302657-26302679 AAAAAGATATTCAAATAGGCTGG - Intronic
1155939142 18:31785846-31785868 AAAAATAACATCATATAGGCTGG - Intergenic
1156910023 18:42400674-42400696 AAAAAGACCCCCAAATATACTGG - Intergenic
1158532059 18:58272473-58272495 AAAAAAATGCACAAATTGGCCGG + Intronic
1159055426 18:63458779-63458801 AAAAAAATCACAAAATTGGCTGG + Intergenic
1159211753 18:65331944-65331966 AAAAATATCCCAAAATACAATGG - Intergenic
1159216695 18:65401086-65401108 AAAAAAATCCACAACTGGGCAGG + Intergenic
1159550594 18:69892019-69892041 AAGAGTAACCCCAAATATGCAGG - Intronic
1159932679 18:74330440-74330462 ACAAATATCCTCAAATATACTGG - Intronic
1159967612 18:74610848-74610870 AAAAATGTCCCAAAATAGGCTGG - Intronic
1160359482 18:78260041-78260063 AAACATATCCCCAAAAAGTAAGG + Intergenic
1160470516 18:79128570-79128592 AAAAAAACCCCCAAATGGCCCGG + Intronic
1161291256 19:3494521-3494543 AAAAAATTCCCAAAACAGGCCGG + Intronic
1161434179 19:4252300-4252322 AAAAAAATACAAAAATAGGCCGG + Intronic
1161901679 19:7123923-7123945 AAAAATATATAAAAATAGGCTGG + Intronic
1162147875 19:8624259-8624281 AAAAATAAACACATATAGGCCGG - Intergenic
1162827234 19:13260642-13260664 AAAAATATATACATATAGGCCGG - Intronic
1162838478 19:13337921-13337943 AAAAATATCTAAAAACAGGCCGG + Intronic
1162920782 19:13901270-13901292 AAAAACACCCCAAAATAGCCAGG - Intronic
1163449926 19:17370758-17370780 AAAAAAATCATCAAATTGGCTGG + Intronic
1163485617 19:17583657-17583679 AAAACTTCCCCCAAACAGGCGGG + Intergenic
1163578855 19:18126236-18126258 AAAAATTTCCACAAATAGCCAGG + Intronic
1164102267 19:22067375-22067397 TAAAATGTCCACAAATATGCAGG + Intronic
1164138273 19:22433844-22433866 AACAAAATCTCAAAATAGGCTGG - Intronic
1164278566 19:23747341-23747363 ATAAAAATCCCCAAAGTGGCCGG + Intronic
1164309360 19:24032807-24032829 AAAAAAATGTCCAAATGGGCGGG + Intergenic
1164959942 19:32419455-32419477 AAAAATAGGTACAAATAGGCCGG - Intronic
1166208389 19:41288538-41288560 AAAAAGATCCCCACCAAGGCCGG - Intronic
1166656295 19:44614408-44614430 AACAAAAACCCCAAACAGGCTGG - Intronic
1166793508 19:45412153-45412175 AAAAAAAACCAAAAATAGGCCGG - Intronic
1167150957 19:47709379-47709401 GAAAATATCCACAACTGGGCTGG + Intergenic
1167475747 19:49700084-49700106 AAAAATAACAACAAATAGCCGGG + Intronic
1168384135 19:55948732-55948754 AAAAATAGGCCCATATGGGCTGG - Intronic
926307631 2:11650460-11650482 AAAAATGCCGCCAAATAGGAGGG - Intergenic
926503865 2:13686470-13686492 AACCACATCCCTAAATAGGCTGG + Intergenic
927072430 2:19544924-19544946 AAAAATATCCCCAACAAAACAGG + Intergenic
927396794 2:22661655-22661677 AATAATAGCCTCAACTAGGCAGG + Intergenic
927775228 2:25897587-25897609 AAAAATATCCAGAAGCAGGCAGG - Intergenic
927892974 2:26764078-26764100 AAAAAGAAACCCAAAAAGGCGGG + Intergenic
928535246 2:32233486-32233508 AAAAATTTCTTGAAATAGGCTGG - Intronic
928544044 2:32312694-32312716 AAAAAAGACCCCCAATAGGCCGG + Exonic
928728002 2:34197577-34197599 AAAAATATCTCCATATAAGCTGG - Intergenic
930310088 2:49729608-49729630 AAAAATAACTAAAAATAGGCCGG + Intergenic
930452800 2:51563634-51563656 TAAAAGATATCCAAATAGGCGGG + Intergenic
931411210 2:62033811-62033833 AAAAATATATCAAAAGAGGCTGG + Intronic
931591095 2:63884322-63884344 TAAACTATCCCCAAATATTCTGG - Intronic
931742310 2:65258277-65258299 AAAAATATATACAAATAGGCTGG + Intronic
932158825 2:69442369-69442391 AAGAATACTCACAAATAGGCCGG - Intergenic
933577520 2:84086631-84086653 CAAAATATCCCCCAAGAAGCAGG + Intergenic
933657480 2:84901532-84901554 AAAAAAATCCCCAAATGAGATGG + Intronic
935228857 2:101078677-101078699 AAAGATGTCCCAAAATAGGGAGG - Intronic
935932397 2:108142102-108142124 AAAAAAAAGCCCAAATAGCCAGG + Intergenic
936592471 2:113817371-113817393 AAAAATATATCCAAAAAGGCCGG + Intergenic
936815025 2:116449908-116449930 ACAAATATTTCCAAATAGGAGGG - Intergenic
938314596 2:130317195-130317217 CAAAATAACCCCAAATGGGATGG + Intergenic
938930032 2:136078607-136078629 AGAAATCTCCCCAAATAGGAAGG + Intergenic
938952840 2:136272207-136272229 AAAAATATCCCAAAAAGGCCAGG + Intergenic
940002222 2:148977815-148977837 ATAGATATCACCAAACAGGCTGG + Intronic
940787669 2:157999472-157999494 TAAAAGAGACCCAAATAGGCTGG - Intronic
941328624 2:164148320-164148342 AAAAATAACCACCAATAGGATGG - Intergenic
941777740 2:169411063-169411085 AAAACTATCCCTAAATATGTTGG - Intergenic
941875933 2:170433276-170433298 AAAATTATCCATAAATATGCTGG + Intronic
942059029 2:172210670-172210692 AAAAATAAACCCAAACTGGCTGG - Intergenic
942149659 2:173062569-173062591 AAAAATCACCTCCAATAGGCCGG + Intergenic
942979852 2:182067687-182067709 AAAAATATATTCAAATATGCTGG + Intronic
944687265 2:202128424-202128446 AAAAAAACCCCCAAAAAGACAGG - Intronic
944795714 2:203182765-203182787 TAAAATTTCCCCAAATATGAGGG - Intronic
945178925 2:207071631-207071653 AAAAATATCCCCAAAACTACTGG - Intergenic
945202571 2:207297433-207297455 ATAAAAATCCCCAGAGAGGCTGG + Intergenic
945208670 2:207359188-207359210 AAAACTATCCCCAGCCAGGCTGG - Intergenic
945260184 2:207835921-207835943 AAACATATTTCCACATAGGCTGG - Intronic
945270678 2:207936266-207936288 AAAAAAATACACAAATAGACTGG - Intronic
945997741 2:216452964-216452986 AAAAATATCCTCAAAAATACTGG - Intronic
946617099 2:221522013-221522035 ACAAAAAACCCAAAATAGGCCGG + Intronic
946820814 2:223627463-223627485 GAAGAAATCCCCAAATAGGTAGG + Intergenic
947775433 2:232705153-232705175 AAAAATATCCAGAAGTTGGCCGG - Intronic
948791488 2:240380013-240380035 AAAAATAGCACAAAATAGTCTGG + Intergenic
1169073287 20:2746792-2746814 AAAAATATCTCCCAATTGGGTGG + Intronic
1170672434 20:18447177-18447199 AAAAATTTCCTCAACTTGGCTGG + Intronic
1171515945 20:25735634-25735656 AATAATATCCCAATAGAGGCGGG - Intergenic
1171955898 20:31463431-31463453 AGAAATACCCAGAAATAGGCCGG - Intergenic
1172218927 20:33258745-33258767 AAAAAAATCCCCAAACATGAAGG - Intergenic
1172489241 20:35321556-35321578 AAAAATATTCCCTTATTGGCTGG + Intronic
1174486307 20:50863552-50863574 GAAAATAGCACCAACTAGGCCGG - Intronic
1174621524 20:51878441-51878463 AAAGAGATCCCCAAATAAGAAGG - Intergenic
1174632239 20:51967906-51967928 AAAAATATCTCCTCCTAGGCTGG - Intergenic
1175459797 20:59143821-59143843 AAGAAAATCCCCAACCAGGCTGG + Intergenic
1179937930 21:44616838-44616860 AAAAATACACCCAAGTGGGCAGG - Intronic
1180463613 22:15590767-15590789 AAAAAAAAAGCCAAATAGGCTGG + Intergenic
1180467995 22:15634089-15634111 AAAAATATACCATAGTAGGCTGG - Intergenic
1180725421 22:17943321-17943343 AAAAATATAACAAATTAGGCAGG - Intronic
1180924323 22:19543427-19543449 ACAAATAAACCCAAATGGGCTGG - Intergenic
1181753116 22:25003706-25003728 AAAATTATCTCCAAGTGGGCCGG - Intronic
1181999346 22:26907593-26907615 AAAAAAATCAAAAAATAGGCTGG - Intergenic
1182190762 22:28458583-28458605 AAATATTTACCAAAATAGGCTGG + Intronic
1182524054 22:30904837-30904859 AGAAAAATCCCCATATGGGCTGG + Intronic
1182849755 22:33462484-33462506 AAAAATATACCCACTGAGGCTGG + Intronic
1183520462 22:38293702-38293724 AAACATAGCCCCAAAGAGGATGG + Intronic
1183877330 22:40794913-40794935 AAAAATATTAAAAAATAGGCGGG - Intronic
1185264117 22:49889448-49889470 AAAAAAAACCCCATAAAGGCAGG - Exonic
949377130 3:3403154-3403176 CAAAATAACCCCAAATAACCTGG + Intergenic
949850501 3:8415801-8415823 AAAAATTTCCCATAAGAGGCTGG - Intergenic
950022581 3:9798424-9798446 AAAAATATGCAAAAATAGTCAGG + Intronic
950068421 3:10132341-10132363 AAAAATAAACACAATTAGGCGGG + Intergenic
951048871 3:18072157-18072179 AAAAATAGGTCCAAATTGGCTGG + Intronic
951228737 3:20151304-20151326 TACAATATCCCCAAATGGGAAGG - Intronic
951336165 3:21424607-21424629 AAAAATACACTAAAATAGGCTGG - Intronic
951859791 3:27239352-27239374 CAAAATTTTCCCAAATTGGCTGG + Intronic
952325476 3:32316651-32316673 AAAAAAATCCCCAAACAAGCAGG - Intronic
952456215 3:33474463-33474485 AAAAATACTCATAAATAGGCCGG + Intergenic
952586784 3:34902796-34902818 CAAAATATACTAAAATAGGCTGG - Intergenic
954865191 3:53722959-53722981 GAAAATATCACCAAGCAGGCTGG - Intronic
955574157 3:60340983-60341005 AAAAAAATTCTCATATAGGCCGG - Intronic
956633988 3:71345091-71345113 TAAAATATACCAAAAAAGGCTGG + Intronic
957286476 3:78223329-78223351 CAAAAGATCCCCAACCAGGCCGG + Intergenic
957675911 3:83364366-83364388 TGAAATAACCCCAAATAGGCCGG + Intergenic
958561034 3:95746637-95746659 AATAATATTCACAAACAGGCTGG + Intergenic
959858020 3:111183608-111183630 TAAAATATTCAAAAATAGGCTGG - Intronic
960125460 3:113993581-113993603 AAAATTAACTCCAAATGGGCTGG + Intronic
961250467 3:125500083-125500105 AAAAAAAAACCCAAAAAGGCAGG + Intronic
963872445 3:150432311-150432333 CAAAACATCTCAAAATAGGCTGG - Intronic
965073462 3:163945822-163945844 ACAAATATTCCAAAAAAGGCTGG + Intergenic
965758552 3:172050678-172050700 GAAAATATACCCACAAAGGCTGG - Intronic
966367190 3:179202364-179202386 ATAAAAATCACGAAATAGGCTGG - Intronic
966842262 3:184099416-184099438 AGAAATATGCACAATTAGGCCGG + Intronic
967110420 3:186288576-186288598 AGAAACCTCCCCAAAGAGGCGGG + Intronic
967584694 3:191197683-191197705 AACAAAATCCACAAATAGGGAGG + Intergenic
968223388 3:196955873-196955895 AATAATAACCCTAAATTGGCCGG - Intronic
968417220 4:450639-450661 TAAAATATCCCAAAAAAGCCGGG + Intronic
968724272 4:2235178-2235200 GAAAATTTCTCCACATAGGCTGG - Intronic
969273003 4:6115737-6115759 AAAAATATCTGCAATTAGCCAGG + Intronic
971116550 4:23653433-23653455 AAAATTATTCCATAATAGGCTGG + Intergenic
971369914 4:26010488-26010510 ACAATTATCTCCAAATAGGTGGG + Intergenic
972120276 4:35693433-35693455 AATAAGTTTCCCAAATAGGCAGG + Intergenic
972757686 4:42065693-42065715 AAAAATAACCACAAATATGGTGG - Intronic
973072218 4:45876827-45876849 AAAAATATCCACAAAAATCCAGG + Intergenic
974109077 4:57505846-57505868 AAAAATACACCCAAAGAGTCTGG - Intergenic
975896354 4:79096575-79096597 AAAATTATCCACAAATAGATTGG + Intergenic
976084716 4:81395554-81395576 AAAAATATCCATTAATCGGCAGG - Intergenic
976506583 4:85853972-85853994 AAAAAAAACCCCAATTAGCCGGG + Intronic
977137324 4:93322007-93322029 AAAAATATCCCAGAAAATGCAGG - Intronic
977817646 4:101433441-101433463 AAAAATATCTCCAAATAAAAAGG + Intronic
978658050 4:111089903-111089925 AAAAATATCTCCAAAGAAGCAGG + Intergenic
979003146 4:115253384-115253406 AAAAATATCCATCAACAGGCTGG + Intergenic
982149165 4:152433199-152433221 AGAAATGTCCACAAATAGGCTGG - Intronic
982869046 4:160552853-160552875 AAAAATATACAGAAGTAGGCAGG + Intergenic
983115251 4:163807753-163807775 AAATATACCCCCAAATATGGTGG + Intronic
983490318 4:168381829-168381851 AAAAATCTCCTCAAATACGCAGG + Intronic
986347980 5:6852324-6852346 AGAGATAGCCCCAAATAAGCAGG + Intergenic
986613329 5:9591639-9591661 GAAAATATGCCCAACAAGGCTGG + Intergenic
987811079 5:22837121-22837143 TAAAATAATCCCAAATAGGCAGG + Intronic
987911821 5:24156372-24156394 AAAAATAACCTCAAAAGGGCAGG + Intronic
988614641 5:32763608-32763630 AAAAAGATGGCCAAAGAGGCTGG - Intronic
988622768 5:32840849-32840871 AAAAAAATTTCAAAATAGGCCGG + Intergenic
989105506 5:37859316-37859338 CAAATTATCACCAAATAGGCAGG + Intergenic
989372843 5:40727983-40728005 AAAAATATGTCAAAATAGACTGG + Intronic
989576243 5:42991337-42991359 AGAAATATCCCCAAATATCAAGG + Intergenic
990889683 5:60634374-60634396 AAAAATAAAAACAAATAGGCCGG + Intronic
992389588 5:76318032-76318054 AGAAAAATCCACAAAGAGGCTGG + Intronic
993240992 5:85385120-85385142 CATAATATCCTCAAATGGGCAGG - Intergenic
993392578 5:87338666-87338688 AAAAATAAGCACAAATAGGCCGG - Intronic
993908453 5:93650692-93650714 AAGAAAATCCACAACTAGGCTGG + Intronic
995070487 5:107915486-107915508 AAAAATTTCCACCAATAGTCTGG + Intronic
995681152 5:114721644-114721666 AAAAGTTTCCCAAAATAGCCTGG + Intergenic
996235382 5:121123224-121123246 AAAAATATGCCCAAAGAGTAAGG - Intergenic
996324482 5:122257521-122257543 AAAAAAAAACCCAAACAGGCTGG - Intergenic
996338771 5:122413197-122413219 AATAAAATCCCCAAATGGGTTGG + Intronic
997145550 5:131429135-131429157 AAAGAAATCCCCAAATATCCTGG + Exonic
998344375 5:141448642-141448664 AAAAATATTTCCATATTGGCCGG + Intronic
998424909 5:142018392-142018414 AAAAAAATCCACAAATGGGGAGG + Intergenic
998547905 5:143047183-143047205 GTAAATATCCCCATAGAGGCAGG + Intronic
998897974 5:146820589-146820611 GAAAATATCCCCAAACAGCATGG - Intronic
999186631 5:149715498-149715520 CAAAATAACTCCAAAAAGGCAGG + Intergenic
999649714 5:153753707-153753729 AAAAAAATCCTCAAATACCCAGG + Intronic
999795292 5:154983256-154983278 AAAAAAATTGACAAATAGGCTGG + Intergenic
1000127967 5:158265852-158265874 AAAAATATCCATGAATAGACAGG + Intergenic
1000755577 5:165155151-165155173 AAAAATATATCCAAAGAGACAGG + Intergenic
1001563431 5:172684651-172684673 AAAATTATCTCAAAATAGGATGG - Intronic
1001995107 5:176151141-176151163 AAAAATACCCCAAATTAGCCAGG - Intergenic
1003889751 6:10553595-10553617 AAAAAAATCATTAAATAGGCCGG + Intronic
1004179628 6:13370018-13370040 AAAAAAATCCACAAAGAGACAGG + Intronic
1004529186 6:16437723-16437745 AATTATATCCTCAAATGGGCTGG - Intronic
1004632006 6:17430830-17430852 AAAAATAACCCCTAATGGCCGGG - Intronic
1004838159 6:19551785-19551807 AAAAATAACCACAAATAACCAGG + Intergenic
1004987637 6:21100682-21100704 AAAAATACCCCAAAATATACAGG - Intronic
1005294498 6:24411830-24411852 AAAAATACCCCCAGAAAGCCGGG - Intronic
1005570192 6:27137987-27138009 AAGAAAATCACCAAATGGGCCGG + Intergenic
1005774517 6:29116256-29116278 AAAAATATTGCCAAACAGGGTGG - Intergenic
1006487657 6:34357071-34357093 AAAAATAACCACAATTTGGCCGG - Intronic
1006494675 6:34413759-34413781 AAAAAAATCTCCTAAGAGGCCGG - Intronic
1006648796 6:35534404-35534426 AAAAACAACCCCATACAGGCAGG - Intergenic
1007608643 6:43134333-43134355 AAAAGTATCCCTAATGAGGCCGG - Intronic
1007892576 6:45309620-45309642 ATAAATATCAACATATAGGCAGG + Intronic
1009728337 6:67563086-67563108 AAAAATACCAACAAATTGGCTGG - Intergenic
1011001503 6:82592877-82592899 AAAAATGCCCCAAAATAGCCAGG - Intergenic
1011369415 6:86617616-86617638 AAAATAATCCCCAAAAAGGCAGG + Intergenic
1011780927 6:90788597-90788619 AAAACATTGCCCAAATAGGCTGG - Intergenic
1013013341 6:106139528-106139550 AAAAATATGCATATATAGGCTGG - Intergenic
1013808879 6:114022193-114022215 AAAAATATCCCTAAGAAGACAGG - Intergenic
1014502454 6:122209053-122209075 AAAAATATCCAGAAATAGAGTGG + Intergenic
1015649303 6:135436896-135436918 AGAAATATGCTCAAATGGGCCGG - Intronic
1015993250 6:138970620-138970642 AAAAATACCCAAAAAAAGGCCGG + Intronic
1016252816 6:142066732-142066754 AAAGAAATCCCCAAATTGGAAGG - Intronic
1016379133 6:143455509-143455531 GAAAATACCCCTAAATGGGCAGG - Intronic
1016906348 6:149154208-149154230 AAAAATAACCCCAAAAAATCTGG - Intergenic
1018197979 6:161371459-161371481 AAAAAAATAACAAAATAGGCCGG - Intronic
1018796411 6:167188670-167188692 AAAAATATCCCAATTTGGGCTGG + Intronic
1018858488 6:167692973-167692995 AAAAATATTTAAAAATAGGCTGG + Intergenic
1020120146 7:5498549-5498571 AAAAATTACCCCAAATGGGCCGG - Intronic
1020201806 7:6085907-6085929 AAAAATATAGACTAATAGGCTGG - Intergenic
1021478018 7:21084937-21084959 AAAAGTATCCCCAAGTTGGGAGG + Intergenic
1021479147 7:21096478-21096500 AAAAAAATCACCAAGTAGGGAGG - Intergenic
1021512207 7:21446200-21446222 AGAAATATCCCCATATGAGCTGG - Intronic
1023443043 7:40204289-40204311 AAAAAAATTCCCAAGTAGGCTGG - Intronic
1023743524 7:43301927-43301949 AAAAATAAACCCAAAGATGCTGG + Intronic
1024777616 7:52806248-52806270 ATAAAAATCCTCAAAGAGGCCGG + Intergenic
1025008823 7:55378834-55378856 AAAAATATACTCCAGTAGGCTGG + Intronic
1025535189 7:61938881-61938903 GAGAATATCCCCAGATAGGAAGG + Intergenic
1025785138 7:64637131-64637153 CAAAAGGTCCCCACATAGGCAGG + Intergenic
1026073008 7:67139346-67139368 CAAAAGATCCATAAATAGGCCGG - Intronic
1026703873 7:72672870-72672892 CAAAAGATCCATAAATAGGCCGG + Intronic
1026907303 7:74069673-74069695 AAAATAATCCCCAAATATCCAGG - Intronic
1026990921 7:74585096-74585118 AAAAAAAACACCAAACAGGCTGG - Intronic
1027127113 7:75564588-75564610 AAAAATATTTACAAATAGGCAGG - Intronic
1027369371 7:77492142-77492164 TAAAATATCCAGAAAAAGGCCGG - Intergenic
1027524290 7:79247052-79247074 AAAAATATCCTCAAACATGGAGG + Intronic
1029237104 7:99130154-99130176 AAAAATACTCCCAAATAGGCTGG + Intronic
1029587000 7:101480660-101480682 AAAAATACCCCCCAAAAAGCTGG - Intronic
1030024541 7:105310388-105310410 AAAAATATGAAAAAATAGGCTGG + Intronic
1030118386 7:106081532-106081554 AGAAAGATACCCGAATAGGCCGG - Intergenic
1030211136 7:106996689-106996711 AAAAATATCCATATGTAGGCTGG + Intergenic
1030541945 7:110842160-110842182 AAAAAAATCCCCAAATAGTTAGG - Intronic
1030639004 7:111983333-111983355 AAAGATATGCCAAAAGAGGCAGG + Intronic
1031667952 7:124508575-124508597 AAAAGTTACCCCAAATAGGCCGG + Intergenic
1031878744 7:127172406-127172428 AAAAATTTCCACAATTTGGCTGG + Intronic
1033251328 7:139762853-139762875 ACAAATATGCCCAAATAAGTGGG + Intronic
1033633071 7:143180665-143180687 AAAAATATAACCAAATAAACTGG + Intergenic
1034003955 7:147447714-147447736 AAAAATTACCCCAAATAGGCTGG - Intronic
1034939945 7:155224104-155224126 AAGAATATCCCCAAATGAGAAGG + Intergenic
1035623552 8:1053241-1053263 AATAATTTGCCCAAATAGACTGG - Intergenic
1036128358 8:6084658-6084680 AAAAATTACCACAATTAGGCTGG + Intergenic
1038352009 8:26784913-26784935 AAAAGTATCTCAGAATAGGCGGG + Intronic
1038978282 8:32725768-32725790 AAAAATATCAGGAAATGGGCTGG - Intronic
1040450273 8:47539155-47539177 TCAAATATCCCACAATAGGCCGG - Intronic
1040515327 8:48129872-48129894 AAAAATATTCACCCATAGGCAGG - Intergenic
1040735646 8:50504638-50504660 AAAAAAACCCCAAAATAGCCAGG + Intronic
1041028270 8:53708956-53708978 AAAAATACCACCTTATAGGCTGG + Intergenic
1041443555 8:57925717-57925739 AAAAAAATACACAAATAAGCTGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042576623 8:70227716-70227738 AAAAATAAACCAAATTAGGCCGG + Intronic
1043690787 8:83148518-83148540 AAAAATATCAGAAAATTGGCCGG - Intergenic
1044386806 8:91598746-91598768 AAAAAACTGCCCAAATTGGCTGG + Intergenic
1045030316 8:98128756-98128778 AAAAAAATCCGCAAATTAGCTGG + Intronic
1045239242 8:100384508-100384530 TAAAATGTCCCCAAATATGGAGG - Intronic
1046116154 8:109786314-109786336 AAAAATAGCTCAAAATATGCAGG + Intergenic
1046931183 8:119843382-119843404 AAAAATATAAAGAAATAGGCTGG - Intronic
1046957287 8:120074630-120074652 AAAAATATCACCAAATGGGGCGG - Intronic
1047471066 8:125172964-125172986 AGAAATAACTCCATATAGGCAGG - Intronic
1047985561 8:130229741-130229763 TAAAAAACCCCAAAATAGGCTGG + Intronic
1048545581 8:135383931-135383953 AAAAAAAAGCCCAAATAGCCCGG - Intergenic
1049652413 8:143777551-143777573 AAAAAAATCCCAAAATATACCGG + Intergenic
1050006051 9:1131522-1131544 AAAAATCTACATAAATAGGCAGG - Intergenic
1050023787 9:1311982-1312004 AAAAAGATCCCCAGGTAGGTTGG + Intergenic
1050433898 9:5589206-5589228 AATGATATTCCCAAATTGGCTGG + Intergenic
1050726485 9:8655283-8655305 ACACATTTCCCCAAAGAGGCAGG - Intronic
1051275522 9:15394575-15394597 AAAAATATCCCAATATGGCCAGG + Intergenic
1051349553 9:16185998-16186020 TTAAATATCCGCAAATAGGCCGG - Intergenic
1051667091 9:19475819-19475841 AAAAATTTCCCAGAATTGGCGGG + Intergenic
1052137641 9:24934611-24934633 GAAAATATCCCAAAACATGCTGG - Intergenic
1053259410 9:36648973-36648995 AAAAAAAACCCCAGATATGCAGG + Intronic
1053882903 9:42613629-42613651 AAAAATATTCCTAAACAGACCGG + Intergenic
1053889766 9:42680673-42680695 AAAAATATTCCTAAACAGACCGG - Intergenic
1054221927 9:62421099-62421121 AAAAATATTCCTAAACAGACCGG + Intergenic
1054228787 9:62488074-62488096 AAAAATATTCCTAAACAGACCGG - Intergenic
1054988199 9:71287432-71287454 ATAAATTACCCCAAATAGGATGG - Intronic
1055448784 9:76411290-76411312 AAAAAAACCCCCAAAATGGCAGG - Intergenic
1055940528 9:81645061-81645083 AAAAATAACACACAATAGGCTGG + Intronic
1058693547 9:107539623-107539645 AAGAATGTCCCCAAACTGGCCGG + Intergenic
1059008998 9:110436084-110436106 AAGAATATCACCAAAGAAGCAGG - Intronic
1059015949 9:110515594-110515616 TAAAATATCCCCACATAGGCCGG - Intronic
1060025110 9:120164309-120164331 TAAAATATGCCCAATCAGGCCGG + Intergenic
1061088005 9:128410474-128410496 AAAAATATTCCCAACTGGCCAGG + Intergenic
1061186191 9:129055372-129055394 TAAAATATACACAAATTGGCTGG - Intronic
1061300088 9:129699124-129699146 AAAAAAATCCATCAATAGGCTGG + Intronic
1061356489 9:130109465-130109487 AAGAATATCCCCAAAGAGGCTGG - Intronic
1186532106 X:10307364-10307386 ATAAACAGCCCCAAATAGGCCGG - Intergenic
1187158991 X:16746876-16746898 AAAAATATCCTTAACTAGGCTGG - Intronic
1187732128 X:22266046-22266068 AATAATATGCCCAAATAGTGGGG - Intergenic
1188836160 X:34957061-34957083 AGAAATAAACCAAAATAGGCTGG + Intergenic
1189237626 X:39500079-39500101 AAAAAAAACCTCAAAAAGGCAGG + Intergenic
1189409476 X:40757082-40757104 AAAAAAATCCCCAAATTAGGAGG + Intergenic
1190762929 X:53451470-53451492 AAAAAGTGCCCCAGATAGGCTGG - Intergenic
1192030462 X:67506925-67506947 AAAAATACCCATAAATTGGCTGG - Intergenic
1193103413 X:77641279-77641301 TTAAAAATGCCCAAATAGGCCGG + Intronic
1193339252 X:80327007-80327029 AGAAATATCCCCAAAATGTCAGG + Intergenic
1193559927 X:83006225-83006247 AAAAATTTGCACAAAAAGGCCGG + Intergenic
1195534660 X:105997744-105997766 TAAAATATCGCCAAAGGGGCTGG + Intergenic
1196630129 X:117928794-117928816 AAATTTATCCCAAATTAGGCAGG + Intronic
1197373530 X:125654377-125654399 AAGAATATCAACAAAGAGGCCGG - Intergenic
1197771628 X:130093014-130093036 AAAAAAATCCACATATAGGCCGG + Intronic
1198317990 X:135488736-135488758 AAAAAAATCCCCAATATGGCTGG + Intergenic
1198549915 X:137734572-137734594 AAAAATCTCTCCACATTGGCCGG + Intergenic