ID: 1099075140

View in Genome Browser
Species Human (GRCh38)
Location 12:78097136-78097158
Sequence AGGTTAGGTCATCAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099075133_1099075140 13 Left 1099075133 12:78097100-78097122 CCTGAGAGCAGCTGGCAGTGTTT 0: 1
1: 0
2: 1
3: 23
4: 219
Right 1099075140 12:78097136-78097158 AGGTTAGGTCATCAGCAATGAGG 0: 1
1: 0
2: 1
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099075140 Original CRISPR AGGTTAGGTCATCAGCAATG AGG Intronic
902634594 1:17726845-17726867 AGGTTATGTCAGCAGCGAGGGGG - Intergenic
903977759 1:27162342-27162364 AGGTCAGGTAACCAGCCATGTGG - Intronic
904788381 1:32999223-32999245 AGGTCAGGCCTTCAGCAATTTGG + Intergenic
906474362 1:46158130-46158152 AGCTTAGATCAGCAGGAATGGGG - Intronic
907702356 1:56801512-56801534 AGATGAGATCATCAGAAATGAGG - Intronic
907775408 1:57509560-57509582 AGGTAAGGTCATCAGCTAATAGG - Intronic
908329386 1:63055703-63055725 CAGTGAGGGCATCAGCAATGGGG - Intergenic
908537844 1:65094982-65095004 AGATAATGTCATCAGCAAAGAGG + Intergenic
908601891 1:65748244-65748266 AGATTATGTCATCTGCAAAGAGG - Intergenic
910918593 1:92318653-92318675 AGGGTACTTTATCAGCAATGAGG - Intronic
911333760 1:96556239-96556261 AGGGTAGGGCATCAGAAATTGGG - Intergenic
917277123 1:173342656-173342678 AGGTTAGGTCATCTGTTAAGAGG - Intergenic
917283865 1:173404557-173404579 AGGTGAGGGCATGAGCCATGTGG - Intergenic
917841336 1:178981815-178981837 AGGTTATGTCATCTGCAATAAGG - Intergenic
923241115 1:232086602-232086624 AGGAGAGGTGATCAGGAATGAGG - Intergenic
923623025 1:235593341-235593363 AGGTCAGGTCAGAAGCACTGGGG - Intronic
1065994713 10:31047339-31047361 AGATTATGTCATCTGCAAAGAGG + Intergenic
1068681806 10:59828005-59828027 AGTTTAGCTCATCAGATATGAGG - Intronic
1068986689 10:63114167-63114189 ATGTTAGGACATCAGGACTGTGG - Intergenic
1069096021 10:64261081-64261103 TGGTTTGGGCATCAGGAATGAGG + Intergenic
1071889535 10:89987952-89987974 AGCTTAGGTCATCAGCGATTAGG - Intergenic
1072313260 10:94177705-94177727 AAGTAAGGTCATAAGGAATGTGG - Intronic
1072425619 10:95327791-95327813 AGGGTAGGTCACCAGAAAGGTGG - Intronic
1073046415 10:100641640-100641662 AGGTTAGGTCTTCAACAAATTGG + Intergenic
1075248214 10:120843744-120843766 AGTTTATGTCATCAGGCATGGGG + Intergenic
1077525230 11:3060260-3060282 AGGTCAGGGCATCAGCAGGGTGG - Intergenic
1078665369 11:13320494-13320516 AGGTGAGGTCATCAGCCAAAGGG - Intronic
1079529656 11:21435108-21435130 AGATTATGTCATCAGTAAAGAGG + Intronic
1086609670 11:88740620-88740642 AGATTAGGACCTCAGCAATCTGG + Intronic
1086733610 11:90279531-90279553 AGATTATGTCATTAGCAAAGGGG + Intergenic
1087944412 11:104140761-104140783 AGGTTAGGACATTAGCAATAGGG - Intronic
1091935431 12:4431002-4431024 AGGTTAGCTTAGAAGCAATGGGG - Intronic
1097456941 12:59811109-59811131 AGGTTAGGTTATCAGAAATGAGG + Intergenic
1098404842 12:70113656-70113678 AGATTATATCATCAGCAAAGAGG - Intergenic
1099075140 12:78097136-78097158 AGGTTAGGTCATCAGCAATGAGG + Intronic
1106019974 13:25905168-25905190 AAGTTAGGTCTTCAGGAATGAGG - Intronic
1107135350 13:36938317-36938339 AGGTGAGGTCAGCAACATTGAGG + Intergenic
1110636049 13:77768024-77768046 AGGTTAGGTCATAAGTTCTGTGG + Intergenic
1114774181 14:25461981-25462003 AGGGGAGGTCATGAGAAATGTGG + Intergenic
1115522437 14:34246358-34246380 ACAGTAGGTCATCAGGAATGTGG - Intronic
1115742255 14:36400661-36400683 ATGCTAGGTCATCAGCATTCTGG - Intergenic
1116604183 14:46968481-46968503 AGATCATGTCATCAGCAAAGAGG - Intronic
1118528706 14:66676237-66676259 AGATTATGTCATCTGCAAAGAGG + Intronic
1121872609 14:97422965-97422987 TGGTAAGTTCATCAGGAATGAGG + Intergenic
1126802190 15:52309047-52309069 AGTTTAGGTCCTCAGCACAGGGG - Exonic
1136131190 16:28222775-28222797 AGGTTAGGTTATTTGCTATGGGG - Intergenic
1137478776 16:48833770-48833792 AGGTTAGGTGATAAGCATAGGGG - Intergenic
1138800459 16:60021002-60021024 AGATTATGCCATCAGCAAAGAGG - Intergenic
1139641038 16:68291599-68291621 AGGACAGGGCAACAGCAATGGGG - Exonic
1141213178 16:81999884-81999906 AGGTCAAGTTATCAGAAATGGGG - Exonic
1145103520 17:20096385-20096407 ATGTCAGGACATCAGTAATGTGG + Intronic
1147320658 17:39643947-39643969 AGGTTAAGTGACCAGCAAGGTGG + Intronic
1148596043 17:48856421-48856443 AAGTTAGGTCTTCATCAGTGTGG - Intronic
1149178186 17:53900724-53900746 AGATTATGTCTTCAGCAAAGAGG + Intergenic
1149877419 17:60249905-60249927 AGGTTGGTTCATATGCAATGAGG - Intronic
1149943321 17:60894495-60894517 AGATCATGTCATCAGCAAAGAGG + Intronic
1150437878 17:65168115-65168137 GGTCTAGGTCATCAGGAATGAGG + Intronic
1150728893 17:67674526-67674548 AGGATATGTCATCAGAAAAGAGG + Intronic
1150728896 17:67674574-67674596 AGGATATGTCATCAGAAAAGAGG + Intronic
1150728899 17:67674622-67674644 AGGATATGTCATCAGAAAAGAGG + Intronic
1150728902 17:67674670-67674692 AGGATATGTCATCAGAAAAGAGG + Intronic
1157689630 18:49670794-49670816 AGTTAAAGTCATCAGCAATGTGG + Intergenic
1159203875 18:65225143-65225165 AGGTTAGATCATGAGGAAGGAGG + Intergenic
1162188907 19:8929367-8929389 AGGTTAGATCATTAGCATAGAGG + Intronic
1163640813 19:18461055-18461077 AGGCTAGGCCATCTGGAATGTGG - Intronic
1164431090 19:28189514-28189536 AGGTGCAGTCCTCAGCAATGAGG - Intergenic
1167141123 19:47651410-47651432 AGGTAAGGGGAGCAGCAATGTGG - Intronic
925185814 2:1845577-1845599 AGGTGAGGAGAGCAGCAATGGGG - Intronic
925553780 2:5106014-5106036 AGGTTAGGTCACCTACAAAGGGG - Intergenic
925849867 2:8069663-8069685 GTGTTAGGTCATCACCAATGTGG - Intergenic
927198342 2:20563407-20563429 AGGTTAGACCCCCAGCAATGAGG + Intronic
931285857 2:60830951-60830973 AGGGCAGGGCATCAGGAATGAGG - Intergenic
931625006 2:64249602-64249624 GGGAGAGGTCATCATCAATGAGG + Intergenic
935039687 2:99414289-99414311 AGGTTAGGAAGTCATCAATGTGG + Intronic
935105484 2:100039580-100039602 AGGCTAGGTCATTGGCCATGGGG - Intronic
935596782 2:104884872-104884894 AGGTTATTTCATAAGGAATGTGG + Intergenic
940213513 2:151280628-151280650 AGGTTTGGTCCTCTGCAAAGTGG + Intronic
942647353 2:178127452-178127474 AGGAAGGGTCATCAGCAGTGAGG - Intronic
943044793 2:182847686-182847708 AAGTGAAGTCATCAGCTATGGGG + Intronic
944286291 2:197953404-197953426 AGGTTAAGTCATGATCCATGGGG - Intronic
947799709 2:232921217-232921239 AGGCCAGGACATCAGAAATGGGG - Intronic
1169054446 20:2609181-2609203 AGCTTAGGCAATCAGGAATGAGG - Intronic
1169341845 20:4802327-4802349 AGTTTTGGTCATCATCACTGGGG - Intronic
1171064297 20:21998321-21998343 AGATTATGTCATCATCAAAGAGG - Intergenic
1177351723 21:19951741-19951763 AGGTTAGGCACTTAGCAATGAGG + Intergenic
1177402220 21:20620239-20620261 AGGTGAGAGCATCAGCAAAGAGG + Intergenic
1179062105 21:37988730-37988752 AGGTTAGGACATCAACATTTTGG + Intronic
1179571439 21:42280994-42281016 GGGTGAGGGCATCAGCAAGGAGG + Intronic
949192463 3:1266855-1266877 GGGCCAGGTCATCAGCAAAGGGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
963634846 3:147781542-147781564 AGTTTAGGTCATCTGCAAACAGG - Intergenic
964796161 3:160499173-160499195 AGGTTTGGTCCAGAGCAATGTGG + Exonic
966409049 3:179630046-179630068 AGGTGAGGCCAGTAGCAATGGGG + Intergenic
972132106 4:35850671-35850693 AGGTGAGGATATCAGGAATGTGG - Intergenic
972588522 4:40461537-40461559 GGTTTAGGTCCTCAGCAACGTGG - Intronic
972806230 4:42531630-42531652 AAGATATGTCATCAGCAAAGAGG - Intronic
974784472 4:66600157-66600179 AGATTATGTCATCAGCAAAGAGG - Intergenic
975538691 4:75480395-75480417 AGTTTAGATCAAAAGCAATGTGG + Exonic
977928859 4:102730320-102730342 AGGGAAGGTCATGAGAAATGTGG - Intronic
978428527 4:108607569-108607591 AGGTTTGCTCATCATCCATGTGG - Intergenic
980624039 4:135348772-135348794 AGATTATGTCATCTGCAAAGAGG - Intergenic
981281453 4:142964551-142964573 AGGTTAGGTCATCTACTAAGGGG + Intergenic
982410604 4:155072281-155072303 ATGATAGGTCATCTGCAATCTGG + Intergenic
982425349 4:155252119-155252141 ACATTAGCTCCTCAGCAATGGGG - Intergenic
982890948 4:160849296-160849318 AGGTTAGGACCTCGGCACTGTGG + Intergenic
984291474 4:177800424-177800446 AGGTTAGGGCTCCAACAATGTGG + Intronic
985290814 4:188385274-188385296 AGATTATGTCATCTGCAAAGAGG + Intergenic
990385334 5:55254988-55255010 AGTTGAGGTAATCAGCAAAGGGG - Intergenic
993401918 5:87464112-87464134 AGATTATGTCATCTGCAAAGAGG + Intergenic
995160721 5:108977792-108977814 AGCTGAGGCCTTCAGCAATGTGG + Intronic
995560259 5:113373619-113373641 AGGTCACGTCATCTGCCATGAGG - Intronic
996125775 5:119723974-119723996 AGATTATGTCATCTGCAAAGAGG - Intergenic
997108601 5:131049037-131049059 TGTTTAGGTCATCAGTAAAGAGG - Intergenic
998730910 5:145075994-145076016 AGATGAGGTCATGAGCCATGAGG - Intergenic
1001835996 5:174833085-174833107 AGGTAAGGTCATCAGGATTGGGG - Intergenic
1003969388 6:11283559-11283581 GGGTGAGGTCATCATCCATGTGG - Intronic
1006246440 6:32741074-32741096 AGGTAAGGTCATCAATAATATGG - Intergenic
1009892453 6:69704090-69704112 AGTTAAGCTCATCAGTAATGGGG - Intronic
1011586945 6:88936316-88936338 AGATTATATCATCAGCAATGAGG + Intronic
1012765359 6:103360559-103360581 AGATTATGTCATCTGCAAAGAGG - Intergenic
1017821012 6:158049141-158049163 AGGTTAGGTAGACAGCCATGAGG - Intronic
1021752911 7:23822557-23822579 AGATTATGTCATCTGCAAAGAGG + Intronic
1023319731 7:38981305-38981327 AGATTAGTTCATCAGTACTGCGG + Intronic
1024405627 7:48976155-48976177 AGGATAGGTGATCCCCAATGTGG + Intergenic
1025624781 7:63211088-63211110 AGGATAGGTGATCGGCAGTGAGG + Intergenic
1027984420 7:85268468-85268490 AGATTATGTCATCAGTAAAGAGG - Intergenic
1028140720 7:87272228-87272250 AGGTTATGTCATCTGCGACGAGG + Intergenic
1030658927 7:112198462-112198484 AGGTTTGGTCATCAGATATGAGG - Intronic
1031134057 7:117866580-117866602 AGGTGGGGTGATGAGCAATGTGG + Intronic
1032491057 7:132324804-132324826 AGGTAGGGACATCAGAAATGGGG + Intronic
1034075275 7:148225495-148225517 AGGTTAGGTCAGCAATAATGAGG + Intronic
1038050501 8:23805932-23805954 AGATGAGGTCAGCAGCATTGAGG + Intergenic
1040093025 8:43418305-43418327 AGTTTATGTCATCTGCAAAGAGG + Intergenic
1040371126 8:46776209-46776231 AGGTCATGTCATCAGCAAAGAGG + Intergenic
1044022273 8:87119508-87119530 AGGTCATATCATCAGCAAAGTGG + Intronic
1044990580 8:97791920-97791942 AGTTTAGTTCATCACCTATGAGG + Intronic
1048139907 8:131784165-131784187 AGCTTAGGTCATGAGCCAAGAGG + Intergenic
1048294407 8:133203687-133203709 AGGGCACGTCATCTGCAATGAGG - Intronic
1048410848 8:134170766-134170788 AGAATAATTCATCAGCAATGGGG + Intergenic
1048992129 8:139766620-139766642 CGGTTAGGTCGTTATCAATGAGG - Intronic
1051933839 9:22419663-22419685 AGATTAGGTCCTCAGCAATATGG - Intergenic
1052495623 9:29219798-29219820 AGTTTAGGTTAAAAGCAATGTGG - Intergenic
1054802784 9:69368122-69368144 AGATTATGTCATCTGCAAAGAGG + Intronic
1055667351 9:78566110-78566132 AGGTTAGAGCATCAGCAAGTTGG - Intergenic
1055689725 9:78816547-78816569 AGGTAAGTTCTTCAGCATTGTGG - Intergenic
1055760420 9:79601033-79601055 GGGTCAGGTGATCAGCAATCTGG + Intronic
1057079141 9:92159290-92159312 AGGTTGGGTCATGAACTATGGGG + Intergenic
1186530512 X:10290568-10290590 AGGTTGGGGAACCAGCAATGAGG + Intergenic
1186812027 X:13199777-13199799 AGGTGAGGTAATTAGAAATGGGG - Intergenic
1187948374 X:24448289-24448311 TGATTAGGTCATCATGAATGGGG - Intergenic
1188579549 X:31693487-31693509 AGATTATGTCATCAGCAAGAAGG - Intronic
1188767082 X:34107175-34107197 AGATTATGTCATCAGCAAACAGG + Intergenic
1191772681 X:64779100-64779122 AGATTATATCATCAGCAAAGAGG + Intergenic
1193071772 X:77314117-77314139 AGGTCATGTCATCTGCAAGGAGG - Intergenic
1195648166 X:107256275-107256297 AGCTGAGGTCATTAGCAGTGAGG + Intergenic
1196577599 X:117338242-117338264 AGATTATGTCATCTGCAAAGAGG + Intergenic
1196998514 X:121411324-121411346 AGATTATGTCATCTGCAAAGAGG + Intergenic
1198192704 X:134325938-134325960 AGATCAGGTCATCTGCAAAGTGG + Intergenic
1198850887 X:140964585-140964607 AGATGAGGTAATTAGCAATGGGG - Intergenic
1199272635 X:145902486-145902508 AAGTTAGGGCAACAGAAATGGGG + Intergenic
1199332482 X:146578897-146578919 AGATCATGTCATCTGCAATGAGG - Intergenic
1201742665 Y:17341144-17341166 AGGGGAGGTCATGAGAAATGTGG - Intergenic