ID: 1099075900

View in Genome Browser
Species Human (GRCh38)
Location 12:78107853-78107875
Sequence GGTTAGTTAGATTTCTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099075900_1099075903 -3 Left 1099075900 12:78107853-78107875 CCACCAGAGAAATCTAACTAACC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1099075903 12:78107873-78107895 ACCACAATGACAAACAATAAGGG 0: 1
1: 1
2: 4
3: 63
4: 552
1099075900_1099075902 -4 Left 1099075900 12:78107853-78107875 CCACCAGAGAAATCTAACTAACC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1099075902 12:78107872-78107894 AACCACAATGACAAACAATAAGG 0: 2
1: 2
2: 17
3: 157
4: 1253
1099075900_1099075905 8 Left 1099075900 12:78107853-78107875 CCACCAGAGAAATCTAACTAACC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1099075905 12:78107884-78107906 AAACAATAAGGGAAAAAGAAAGG 0: 1
1: 9
2: 62
3: 286
4: 2392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099075900 Original CRISPR GGTTAGTTAGATTTCTCTGG TGG (reversed) Intronic
902004949 1:13224824-13224846 GGATGGTGAGCTTTCTCTGGGGG - Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
906204061 1:43977857-43977879 GGTTAGTCATATATCTCTTGTGG + Intronic
906613645 1:47220352-47220374 GGTTGGTTACATCTGTCTGGAGG - Intronic
906925083 1:50106975-50106997 ATTTACTTAGATTTCTCTGGAGG - Intronic
909932553 1:81514153-81514175 GGTTGGGGAGATTTGTCTGGAGG + Intronic
910024867 1:82638026-82638048 GGGTAGTTTAAGTTCTCTGGAGG - Intergenic
910621381 1:89259608-89259630 GGCTTGTTATATTCCTCTGGGGG - Intronic
911848894 1:102789326-102789348 GGTTGCTTTGACTTCTCTGGAGG + Intergenic
913682871 1:121203526-121203548 TGTTACTTAGATTCCTCTGATGG + Intronic
914034712 1:143991151-143991173 TGTTACTTAGATTCCTCTGATGG + Intergenic
914154740 1:145076817-145076839 TGTTACTTAGATTCCTCTGATGG - Intronic
915001533 1:152598216-152598238 TGCTAGTTGGATTTCTGTGGTGG + Intronic
919364692 1:196642788-196642810 GGTTTGATAATTTTCTCTGGTGG - Intergenic
920470181 1:206222039-206222061 TGTTACTTAGATTCCTCTGATGG + Intronic
920556578 1:206909005-206909027 GGTAATTTACCTTTCTCTGGAGG - Intronic
924821471 1:247495127-247495149 GGTTAATCTGATTTCTCTGTAGG + Intergenic
1064597406 10:16960052-16960074 CGGCAGTTAGAATTCTCTGGGGG - Intronic
1065652522 10:27907550-27907572 TGTAAGTCAGATTTATCTGGTGG - Intronic
1066926896 10:41707043-41707065 GGATATTTAGATTTCTGTGAGGG + Intergenic
1067393583 10:45889051-45889073 GTTGAGTTTGCTTTCTCTGGAGG - Intergenic
1067861907 10:49858194-49858216 GTTGAGTTTGCTTTCTCTGGAGG - Intronic
1068939264 10:62664761-62664783 GTTTCGTTAGGTTTCCCTGGAGG - Intronic
1071069670 10:81677043-81677065 TATTAGTTAGGGTTCTCTGGAGG + Intergenic
1072565952 10:96616865-96616887 GAGTATTTGGATTTCTCTGGGGG - Intronic
1073446891 10:103586348-103586370 GTTTCGTTAGATTTACCTGGAGG + Intronic
1076156061 10:128206774-128206796 GGTGAGTCATATTTCCCTGGTGG + Intergenic
1086140973 11:83499909-83499931 TATTAGTCAGAGTTCTCTGGAGG - Intronic
1087346561 11:96978982-96979004 GATAAGGCAGATTTCTCTGGAGG - Intergenic
1090242650 11:125194871-125194893 GGTTAGTTATTATTATCTGGAGG - Intronic
1092582842 12:9864731-9864753 GGTTATATAATTTTCTCTGGTGG - Intronic
1095166330 12:38977524-38977546 GTTTACTTAGAATCCTCTGGGGG + Intergenic
1095364726 12:41389070-41389092 GGATAGTTAAATGTCTCTGCAGG + Intronic
1096004632 12:48159182-48159204 AGTTAGTTTGATTTCTCTAGGGG - Intronic
1096359730 12:50973394-50973416 GGTCTGTTAGAGTTTTCTGGAGG - Intergenic
1099075900 12:78107853-78107875 GGTTAGTTAGATTTCTCTGGTGG - Intronic
1101104868 12:101429858-101429880 GGTGAGTTGGATTTATATGGAGG - Intergenic
1104138576 12:125963975-125963997 GTTTAGGTGGATTTCTCTGGGGG - Intergenic
1110595067 13:77311285-77311307 GGTTTATTATAATTCTCTGGAGG - Intronic
1114804500 14:25819103-25819125 GGTTATTTAAATTTCACAGGTGG + Intergenic
1117042389 14:51778859-51778881 GGTTAGCTAGGCTTATCTGGAGG - Intergenic
1121179310 14:91916549-91916571 GGAGAGTTAGTTTTCTTTGGGGG + Intronic
1121672261 14:95721109-95721131 GGTTAGATGGTTTTCTCTAGTGG + Intergenic
1127876027 15:63112214-63112236 TTTTAGTTAGATTTCTCTGTGGG - Intergenic
1127941382 15:63700425-63700447 TGTTAGTTTGTTTTCTCTGTGGG - Intronic
1136265085 16:29111517-29111539 AGGTGGTTAGATTTCCCTGGTGG + Intergenic
1140070210 16:71642680-71642702 GGTTGGTGGTATTTCTCTGGAGG - Intronic
1140945542 16:79764964-79764986 GGGCAGTTAGATGTCACTGGAGG - Intergenic
1142053882 16:87979492-87979514 AGGTTGTTAGATTTCCCTGGTGG + Intronic
1142898491 17:2997419-2997441 GCTTTGTTAGTTTTCTCAGGTGG + Intronic
1144362263 17:14506805-14506827 TGTAAGTTGTATTTCTCTGGTGG - Intergenic
1148168420 17:45500426-45500448 GGTTAGTGAAATTTCTGTGGAGG - Intergenic
1148280393 17:46342514-46342536 GGTTAGTGAAATTTCTCTAGAGG + Intronic
1148302621 17:46560451-46560473 GGTTAGTGAAATTTCTCTAGAGG + Intronic
1148925377 17:51080162-51080184 GGTAAGTTAGATTTGAGTGGTGG - Intronic
1150244775 17:63666102-63666124 TGTTGCTTAGTTTTCTCTGGCGG + Intronic
1150399611 17:64846877-64846899 GGTTAGTGAAATTTCTCTAGAGG - Intergenic
1151069012 17:71187001-71187023 TGTTAGTCAGAGTTCTCTAGAGG + Intergenic
1157037365 18:43991103-43991125 TTTGAGTTATATTTCTCTGGTGG + Intergenic
1160389666 18:78520643-78520665 GTTTACTTAGATTTCCCTGTTGG + Intergenic
1164091058 19:21952546-21952568 GGTTTGTTGGAATTTTCTGGAGG - Intronic
1166844236 19:45717195-45717217 GGTTTGGAAGATTTCTTTGGGGG - Intronic
925549384 2:5054560-5054582 GATTATTTAGATTTCACTGTGGG + Intergenic
929552393 2:42902929-42902951 GGTTCTTTAGATTTACCTGGGGG + Intergenic
930996642 2:57727525-57727547 GTTTAGTTAGAGTATTCTGGTGG - Intergenic
932540047 2:72641959-72641981 GGTTTGTTAGAGTTTGCTGGAGG - Intronic
933788378 2:85862991-85863013 GGTTAATTAAATTTCCCTGAAGG - Intronic
935330122 2:101970950-101970972 GGATATTTAACTTTCTCTGGTGG + Intergenic
935674475 2:105582291-105582313 GGTTTATTAGATTTCTATGGTGG - Intergenic
936904747 2:117524656-117524678 GATTAATTAGAATTATCTGGAGG - Intergenic
936983236 2:118284006-118284028 GTTTAGTTAGGTTTCTTTAGGGG + Intergenic
939188110 2:138884048-138884070 GTTTAGTTAAGTGTCTCTGGAGG + Intergenic
940157320 2:150671602-150671624 GGTTTGGTAGATTTCTGTAGTGG + Intergenic
940676851 2:156733829-156733851 GATTGGTTCTATTTCTCTGGAGG + Intergenic
940764715 2:157777872-157777894 AGTTAGTTACTTTTCTCTGAGGG - Intronic
941704947 2:168648333-168648355 GGTTATTTTTATTTCTGTGGGGG + Intronic
943836324 2:192518146-192518168 GGTTAGATACATGTCTCTGGTGG - Intergenic
945789867 2:214291779-214291801 GGTTAGGTAGTTTTCTGTAGTGG + Intronic
945898824 2:215515400-215515422 GGATAGTTGCATTTTTCTGGAGG + Intergenic
947819876 2:233062152-233062174 GGTTACTTGGATTTCTCTCCTGG + Intronic
948103223 2:235391938-235391960 GGTGGGCCAGATTTCTCTGGGGG + Intergenic
1171104032 20:22415121-22415143 TGATAGGTAGATTTTTCTGGTGG - Intergenic
1173925090 20:46775141-46775163 GGTTAGTCAAATTCCTCTGTCGG - Intergenic
1176904652 21:14484695-14484717 GATTAGAAAGATTTATCTGGAGG + Intergenic
1177477754 21:21645556-21645578 TGCAAGTTAGATTTCACTGGGGG - Intergenic
1181076933 22:20385083-20385105 TGCCAGTTAGATTTCTGTGGTGG + Intronic
1182011434 22:27003931-27003953 ATTTAGTTACATATCTCTGGTGG - Intergenic
1183027753 22:35078778-35078800 GGCTAGTGAGATTTCTCTCTGGG - Intronic
1183685045 22:39356855-39356877 GGATAGTTGGATTGCTCTGGTGG + Intronic
1183917881 22:41137441-41137463 GGTAAGTTGTATTTCTTTGGAGG - Intronic
1185072632 22:48665819-48665841 GGTTCGTTAGCGTTCTCGGGAGG - Intronic
955874906 3:63478621-63478643 TGATATTTACATTTCTCTGGGGG - Intronic
957876190 3:86149342-86149364 AGATAGTCAGATTTCTTTGGGGG + Intergenic
958957753 3:100479818-100479840 GGTTAGTTGGAGTTTGCTGGAGG + Intergenic
959822384 3:110751979-110752001 TGCTGGTTAAATTTCTCTGGTGG + Intergenic
959908614 3:111737728-111737750 GCCTAGTTAGAGTTCTCTGCAGG - Intronic
960657786 3:120025056-120025078 GGATAGTAAGATTCTTCTGGGGG + Intronic
963291655 3:143496383-143496405 TGTTAGGTAAATATCTCTGGAGG + Intronic
964690526 3:159444544-159444566 GGTTAATTGAATTTCTCTGAGGG + Intronic
968245643 3:197144321-197144343 TGTTGGTTAGATCTCTCTGTAGG - Intronic
970632529 4:17966247-17966269 GGCTAGCCAGATTTGTCTGGAGG - Intronic
971666393 4:29491698-29491720 GGTTTGTTTGATTTTTGTGGTGG + Intergenic
972158247 4:36191818-36191840 GGTGAGTTAGATTTCTTTGCAGG + Intronic
972203960 4:36748274-36748296 GGTTGGTTGGATATCTCTGCAGG - Intergenic
973853791 4:54989095-54989117 GGTTTGGTAGATTTCTGTAGTGG - Intergenic
974853469 4:67430957-67430979 TATTAGTTAGAGTTCTCTAGAGG - Intergenic
974855731 4:67458393-67458415 TGTTGGTTCTATTTCTCTGGAGG + Intergenic
975257403 4:72254459-72254481 TGTTAGTCAGGTTTCTCTAGAGG - Intergenic
977701390 4:100027060-100027082 GGTTAGTCAGGGTTCTCTAGAGG + Intergenic
977718686 4:100212898-100212920 GGTTAGATAGATGTCTGTTGTGG - Intergenic
978275228 4:106941174-106941196 AGTTAGGTAGAGTTCTGTGGTGG - Intronic
980212457 4:129807471-129807493 TGTAAGTTTGATTTCTCTGATGG + Intergenic
983041218 4:162930018-162930040 GCCTTGTTATATTTCTCTGGAGG + Intergenic
983362477 4:166744356-166744378 GGTTTGTTGGAGTTTTCTGGAGG - Intronic
984038385 4:174697904-174697926 GGTTGGTTGGATTTCACTGTAGG + Intronic
986467637 5:8042316-8042338 GGTTAGTTAGTTTCTTCTGAGGG + Intergenic
986862769 5:11947649-11947671 GGTAAGTTCGGTTTCTCTTGAGG + Intergenic
987029180 5:13960197-13960219 GTTGAGTTAGGTTACTCTGGTGG + Intergenic
989081622 5:37628793-37628815 GGTTAGGTGGTTTTCTCTAGTGG + Intronic
990402753 5:55455897-55455919 GGTTCATTAGAGTTATCTGGAGG - Intronic
990776921 5:59313520-59313542 GCTTGGTTAGATTTCTTTGCTGG - Intronic
993471523 5:88313242-88313264 GGTTTGTTGGAGTTTTCTGGAGG + Intergenic
995208984 5:109515520-109515542 GGTTAGTTGGGTTTCTGGGGAGG + Intergenic
995968487 5:117938831-117938853 GGAGAGTTAGATTTCCCTGCAGG + Intergenic
997063148 5:130530819-130530841 AGTTTGTTAGATTTTTCTGTTGG + Intergenic
1003691749 6:8361728-8361750 TATTAGTCAGATTTCTCTAGAGG + Intergenic
1003807615 6:9743168-9743190 GGTTATTTATATTTCTGGGGGGG + Intronic
1003816690 6:9849566-9849588 GGTTAGGTACAGTGCTCTGGAGG - Intronic
1003942813 6:11044847-11044869 GGTTGGGTGGGTTTCTCTGGGGG + Intergenic
1004993494 6:21164909-21164931 GATGAATTAGATTCCTCTGGTGG - Intronic
1005435444 6:25806122-25806144 GGTTAGCTAGAATTTTGTGGAGG - Intronic
1011223987 6:85086857-85086879 GGTTCTGTAGATTGCTCTGGAGG + Intergenic
1011727732 6:90227670-90227692 GGTTAGTTATGCTTCTCTTGAGG - Intronic
1014995253 6:128135126-128135148 ATTTAGTTCTATTTCTCTGGAGG + Intronic
1015001033 6:128215965-128215987 GGTTAGTAATATTTATTTGGTGG + Intronic
1015128642 6:129784869-129784891 GCTGAGTTAGAATTCTGTGGGGG - Intergenic
1015188441 6:130445725-130445747 GGTTGCTTTGATTTCTCTTGAGG + Intergenic
1016224209 6:141715101-141715123 TATTAGTTAGGGTTCTCTGGAGG + Intergenic
1016831526 6:148438527-148438549 GGTTAATGAGAGTTCTATGGAGG + Intronic
1021431404 7:20562513-20562535 TATTAGTCAGAGTTCTCTGGAGG + Intergenic
1021998212 7:26201143-26201165 GGCTACTAAGATTTTTCTGGCGG - Exonic
1023636303 7:42214282-42214304 GGTTTGATTGGTTTCTCTGGGGG - Intronic
1031327158 7:120416001-120416023 AGTTACTCAGATATCTCTGGAGG - Intronic
1042364245 8:67918232-67918254 GGTTACTTAGCATACTCTGGAGG + Intergenic
1042827569 8:72994018-72994040 TATTAGTTAGCTTTCTCTAGAGG - Intergenic
1043098567 8:76009316-76009338 TGTGAGTTATATTTCTCTGCTGG + Intergenic
1043551972 8:81384775-81384797 GATTTGGTAGATTTCTGTGGTGG + Intergenic
1047089183 8:121555052-121555074 GGTTGGTTAGATATCTTTGCTGG - Intergenic
1047586044 8:126274241-126274263 GGATATTTACTTTTCTCTGGTGG - Intergenic
1048195612 8:132329616-132329638 GGTTAGTTAGAGCTATCTGGGGG - Intronic
1048401878 8:134079134-134079156 GGTTTGTTATAATTCTTTGGGGG + Intergenic
1050254858 9:3783683-3783705 GATTAGTGAGTCTTCTCTGGTGG - Intergenic
1050645392 9:7713778-7713800 GGTCTGTTAGAGTTTTCTGGAGG - Intergenic
1054890876 9:70250432-70250454 GGTTAGCTAGAGTTCTTTGTTGG - Intergenic
1055361185 9:75492047-75492069 GGTTACTGAGATTTCTCAGCAGG - Intergenic
1187259382 X:17671116-17671138 GGTGAGTTTGATTTCTCTTCAGG - Intronic
1187819946 X:23276718-23276740 GGTGCGTCAGAATTCTCTGGAGG - Intergenic
1188831816 X:34907494-34907516 AATTTGTGAGATTTCTCTGGAGG + Intergenic
1189239568 X:39515254-39515276 GGTTAGGGTGCTTTCTCTGGGGG - Intergenic
1190498363 X:51050098-51050120 GGTTAGGTATTTTTCACTGGTGG - Intergenic
1191664760 X:63689017-63689039 GTTTAGTGATTTTTCTCTGGTGG - Intronic
1191929594 X:66356090-66356112 GGTTGTTTATATTTCTGTGGGGG - Intergenic
1192333806 X:70201130-70201152 GGTAAGATACATTTCTGTGGAGG + Intronic
1193338652 X:80320153-80320175 GGTCAGTTGGAGTTTTCTGGAGG - Intergenic
1197142056 X:123128840-123128862 GGTTATTTGTATTTCTTTGGGGG - Intergenic
1197386844 X:125812856-125812878 TTTTAGTTAGATTTCTCCAGAGG - Intergenic
1199432387 X:147776215-147776237 GGCTAGTTACTTCTCTCTGGTGG + Intergenic
1200396803 X:155995184-155995206 GTTCTGTTATATTTCTCTGGAGG + Intergenic