ID: 1099077365

View in Genome Browser
Species Human (GRCh38)
Location 12:78127352-78127374
Sequence GGGCTATCTCACCAACTGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099077365_1099077370 7 Left 1099077365 12:78127352-78127374 CCGAACAGTTGGTGAGATAGCCC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1099077370 12:78127382-78127404 AGAGATACTAGTAGAGATTGAGG 0: 1
1: 0
2: 0
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099077365 Original CRISPR GGGCTATCTCACCAACTGTT CGG (reversed) Intronic