ID: 1099077365 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:78127352-78127374 |
Sequence | GGGCTATCTCACCAACTGTT CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 85 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1099077365_1099077370 | 7 | Left | 1099077365 | 12:78127352-78127374 | CCGAACAGTTGGTGAGATAGCCC | 0: 1 1: 0 2: 0 3: 6 4: 78 |
||
Right | 1099077370 | 12:78127382-78127404 | AGAGATACTAGTAGAGATTGAGG | 0: 1 1: 0 2: 0 3: 16 4: 161 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1099077365 | Original CRISPR | GGGCTATCTCACCAACTGTT CGG (reversed) | Intronic | ||