ID: 1099078177

View in Genome Browser
Species Human (GRCh38)
Location 12:78138815-78138837
Sequence AAAAGCCATCTTGCCCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099078177_1099078178 22 Left 1099078177 12:78138815-78138837 CCTAAGTGGGCAAGATGGCTTTT 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1099078178 12:78138860-78138882 GAACTATTCTAGTTCTTAAATGG 0: 1
1: 0
2: 0
3: 11
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099078177 Original CRISPR AAAAGCCATCTTGCCCACTT AGG (reversed) Intronic
902172139 1:14620662-14620684 AGAAGGCCTCTTGCCCACTGTGG - Intronic
902577658 1:17388610-17388632 AAAAGCCATCTCCCACAGTTGGG + Intronic
904906513 1:33901129-33901151 GAATGCCATCTTGCCCCATTGGG - Intronic
907270081 1:53285886-53285908 AAAAGCCCCCTTGCCAGCTTTGG - Intronic
907339851 1:53727150-53727172 AAAAGCCATGTGGCCGCCTTTGG + Intronic
907809943 1:57859100-57859122 AAAAGCCATCTCGGCTGCTTAGG - Intronic
908589914 1:65619546-65619568 AAAAGGAGTATTGCCCACTTTGG + Intronic
911165364 1:94720014-94720036 AAAAACCATCATGCCCTCTAAGG + Intergenic
912926362 1:113916656-113916678 AAAATCCATCTTTTCCACTATGG - Intergenic
916668056 1:166984952-166984974 AAAAGCCATCTTGCCCAAGGTGG + Intronic
916677158 1:167073659-167073681 TAGAGCCATCTTGGCCACCTTGG + Intronic
917030679 1:170687093-170687115 AAAGGTCATCTTGACCATTTAGG + Intronic
918764142 1:188456864-188456886 AGATACCATCTTGTCCACTTGGG - Intergenic
919729502 1:200903857-200903879 AAAAACCACCCTGCCCCCTTGGG + Intronic
922539195 1:226406409-226406431 AAGAGCCTTGTTGCCCACTAAGG - Intronic
923278164 1:232416231-232416253 AAAAATTATCTTGGCCACTTTGG - Intronic
924149966 1:241119977-241119999 CAAAGCCATCTTCCACACTGTGG + Intronic
924774695 1:247107861-247107883 ACCAGCCCTCTTCCCCACTTTGG + Intergenic
1062823505 10:551712-551734 CACAGCCATCTTGCCCACACAGG + Intronic
1063947978 10:11195884-11195906 AAAAGCCATGTTTCCAACTTAGG - Intronic
1065613887 10:27500610-27500632 AAATGTCATTTTGACCACTTGGG - Intergenic
1067320874 10:45219678-45219700 AAAAGCCACCGTGGCCACTGGGG + Intergenic
1069799005 10:71070747-71070769 AAAAGACAGATTGTCCACTTCGG + Intergenic
1070913187 10:80135889-80135911 AAAAGCAACCCTGGCCACTTGGG - Intronic
1071891065 10:90007997-90008019 AGTGGCAATCTTGCCCACTTGGG + Intergenic
1073849732 10:107600819-107600841 TAAAAGCATCTTGCGCACTTTGG + Intergenic
1084135254 11:67173995-67174017 ATGAGCCACCATGCCCACTTTGG + Intronic
1091044917 11:132316892-132316914 AAAAGCCAACAAGCACACTTGGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1091882611 12:3991611-3991633 CTAAGCTATCTTGCCCACCTAGG + Intergenic
1092567799 12:9686291-9686313 ATCAGCCATCTTGCCCTCTCTGG + Intronic
1092824949 12:12390063-12390085 AAAAGCCATCTTTTCCACATAGG + Intronic
1095606359 12:44072401-44072423 AAAAGCCATCTTTTCTACTGAGG - Intronic
1096610410 12:52797266-52797288 GAAAGCCATCCTGCACACTCTGG + Intergenic
1096616828 12:52838042-52838064 AAAAGCCTTCTTGCATAATTTGG + Intronic
1099078177 12:78138815-78138837 AAAAGCCATCTTGCCCACTTAGG - Intronic
1100440263 12:94610372-94610394 AAAAACCATCTAGCCCTTTTGGG + Intronic
1108425342 13:50293481-50293503 AAAAGCAATCCTGCTCATTTGGG - Intronic
1109006557 13:56884786-56884808 AATAGCAAATTTGCCCACTTAGG - Intergenic
1111358742 13:87146095-87146117 GAAAACCATCTTCCCCTCTTAGG - Intergenic
1112822194 13:103350597-103350619 AAAAGCTATAATGCCCATTTAGG + Intergenic
1117052328 14:51873841-51873863 AAAAGATATCTTGCTTACTTGGG - Intronic
1119483891 14:74976013-74976035 AAAAGCCCTTTTGCACTCTTTGG + Intergenic
1120295205 14:82631476-82631498 AAAAGTCATCATGGCCATTTTGG - Intergenic
1125249710 15:37686271-37686293 AATAGCCACCTTGCCCAATATGG + Intergenic
1126216857 15:46165372-46165394 AAAAGCCACCTTAGTCACTTCGG - Intergenic
1131028254 15:89163693-89163715 AAAAGACATTTTCCCCACTTTGG + Intronic
1131102606 15:89704915-89704937 TAAAGGCATCTGGCCCACTGTGG - Intronic
1133276602 16:4641886-4641908 TCAAGCCATCTTGCCCACCTTGG + Intronic
1137259013 16:46806800-46806822 AAAAGTCATTTTTCCCCCTTTGG + Intronic
1137929633 16:52574740-52574762 AACACCAATCTTGCTCACTTTGG - Intergenic
1140085730 16:71794734-71794756 AATAGCCATCTTCACCATTTTGG - Intronic
1140277874 16:73527103-73527125 AAAAGCAATCTTGCCATCTCAGG + Intergenic
1143978003 17:10844490-10844512 AAAAGGCTTCTTGCCCTCCTTGG - Intergenic
1144511481 17:15880876-15880898 GTAAGCAATCTTGCCCAATTAGG - Intergenic
1145122976 17:20277326-20277348 GTAAGCCATCTTACCCAATTAGG - Intronic
1146001219 17:29131685-29131707 ACCAGCCACTTTGCCCACTTTGG + Intronic
1148589061 17:48801766-48801788 GGAAGCCATCTTGCCCTCTCTGG + Intronic
1149218569 17:54388514-54388536 TAAAGCAAGCTTGACCACTTAGG - Intergenic
1149420185 17:56503001-56503023 AGAAGCCAACTTTCCCCCTTGGG - Intronic
1150711421 17:67533708-67533730 GGAAGCCATCTTAACCACTTTGG - Intronic
1151578882 17:74966752-74966774 AAAAGCCATGTTGCCCAGGCTGG - Intronic
1152466968 17:80471894-80471916 AAAAGGCAACTTGGCCACCTGGG + Exonic
1153977716 18:10284056-10284078 CAAATCCACCTTGGCCACTTTGG - Intergenic
1157492552 18:48134648-48134670 AAATGCCATCCTGGCCACTGAGG + Intronic
1158556190 18:58476652-58476674 AAATGCCATCCTGTTCACTTTGG + Intergenic
1161919013 19:7252427-7252449 AAAAGGAATCTTGACCACTTTGG + Intronic
1164694309 19:30232123-30232145 GGAAGCCATCTGGCCCACCTGGG + Intronic
929584671 2:43106197-43106219 AAAAGTCCTCTTGCCAAGTTTGG + Intergenic
933611709 2:84443460-84443482 AAAAGCAATCTTAGCAACTTAGG + Intronic
934727975 2:96637502-96637524 AAAACCCTTCCTGCCCACCTAGG - Intronic
936551886 2:113450902-113450924 AAAAGCCACATTGCCCCATTTGG - Intronic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
938739675 2:134219257-134219279 ACAAGCCTTGTTGCCCACCTTGG - Intronic
940338462 2:152554170-152554192 TCAAGCCATCCTGCCCACCTTGG - Intronic
941925656 2:170891927-170891949 AAAGGCCATCTTACCATCTTTGG - Intergenic
941959865 2:171242885-171242907 TAAAGCAATCTTTCCCACCTTGG - Intergenic
942818358 2:180079722-180079744 AAAATCTATCTTGACCATTTGGG - Intergenic
943028503 2:182657484-182657506 AAAATAAATCCTGCCCACTTAGG - Intergenic
944568772 2:201020649-201020671 AAAAGCCATCTGTTCTACTTAGG - Intronic
948972839 2:241442520-241442542 AAAACCCATCTTGACCACTCTGG + Intronic
1169650967 20:7866668-7866690 AAAAGCCTTCTAGTACACTTTGG - Intergenic
1169823865 20:9744330-9744352 AGAAGCCATATTGCTTACTTGGG - Intronic
1170542156 20:17400304-17400326 AAAAGCAAGATTGCACACTTAGG + Intronic
1174756648 20:53165649-53165671 AAAACCTGTCTTGCCCAATTGGG + Intronic
1176888613 21:14286457-14286479 AAAAGCCATCTTTGCCACTACGG - Intergenic
1178304931 21:31483573-31483595 AAAACCAATCTTGGCCCCTTGGG - Intronic
1181618437 22:24071144-24071166 AGAAGCCATCATGTCCCCTTTGG - Intronic
1182075809 22:27494735-27494757 AAAAGCGATCTTGCCCATCTCGG - Intergenic
1184649254 22:45912229-45912251 AAGAGGCATCGTGCCCACTGAGG + Intergenic
950214569 3:11150357-11150379 AAGGGCCATCCTGCCCACTTGGG + Intronic
956398351 3:68849559-68849581 TAAAGCCATCTTGGACCCTTCGG + Intronic
957378993 3:79399572-79399594 AAAAGCGATCATGCCCATTCTGG + Intronic
957435477 3:80169313-80169335 AAAAACCATCTTGGCCACACAGG - Intergenic
959008002 3:101042437-101042459 AAAGGCTATCATGACCACTTTGG - Intergenic
959140998 3:102486780-102486802 AGAAGCCATTTTTCCCTCTTAGG - Intergenic
964385897 3:156147473-156147495 AGAAACCATATTGGCCACTTTGG + Intronic
965332650 3:167395831-167395853 GAAAGCCATGTAGCCTACTTTGG + Intergenic
967277909 3:187794856-187794878 AAAAGACAACTTGCAAACTTTGG + Intergenic
970477593 4:16439417-16439439 ATAAGCCATTTTCCCAACTTGGG - Intergenic
970895027 4:21092439-21092461 AAAAGCAATATTGACCACTCTGG - Intronic
970910154 4:21265459-21265481 AAAAGCCATCTTCCATACTGTGG - Intronic
973221293 4:47730491-47730513 AAAAAAGAGCTTGCCCACTTGGG + Intronic
973755825 4:54072451-54072473 AAAAGTCATCTGGCCCACACTGG + Intronic
973998666 4:56486927-56486949 TAGAGCCATGTTGCCCAGTTTGG + Intronic
974523774 4:63020780-63020802 AATAGCCATCTTTCTGACTTGGG - Intergenic
981033439 4:140149149-140149171 AAAAGCCATCTTTTCAACTGAGG + Intronic
981115012 4:140979750-140979772 AAATGGCAACTTGCCCAGTTTGG - Intronic
982353114 4:154437887-154437909 ATGAGCCATCATGCCCAGTTAGG - Intronic
989274102 5:39566693-39566715 AAAAGGCATCTTAGCCTCTTGGG - Intergenic
992258840 5:74949955-74949977 AAAAGCCATCTTTCTCCATTGGG - Intergenic
994200421 5:96968352-96968374 AAAAGTAATCCTGCCAACTTGGG - Intronic
997379592 5:133426152-133426174 AGAAGTCATCTTTCCCAGTTAGG + Intronic
998418205 5:141960449-141960471 AGGAGCCAGCCTGCCCACTTCGG - Intronic
999798417 5:155009605-155009627 GAGAGCCACCTTGACCACTTTGG + Intergenic
1006969123 6:38022286-38022308 TAAAGCCTTCTTGCCTACTTTGG - Intronic
1007394717 6:41570861-41570883 AAAAGCCAGCTCTCCCACTGAGG - Intronic
1008934839 6:56979604-56979626 AAAAACCATCTTGCTTAATTGGG - Intronic
1009928620 6:70149770-70149792 CAAAGCCAGCTTGCTTACTTGGG + Intronic
1011094970 6:83650877-83650899 AAAAACCATCAGGCCCACATGGG - Intronic
1011535986 6:88376586-88376608 AAAATCCCACATGCCCACTTGGG + Intergenic
1013995153 6:116299744-116299766 AAAAGTTATCTTGGCCTCTTAGG - Intronic
1021050767 7:15981633-15981655 AACTGCCATCTGGGCCACTTTGG - Intergenic
1021153610 7:17181853-17181875 AAAAGCCAGCTGGCTCACTCAGG - Intergenic
1021372929 7:19872595-19872617 AAAAGCCATCCTGTCCACTATGG - Intergenic
1021942363 7:25690254-25690276 CAAAGCCATGTTGCCCACATTGG - Intergenic
1023192338 7:37596207-37596229 AAAAGCTAACTTGTTCACTTGGG - Intergenic
1023233236 7:38055595-38055617 ATGAGCCATCATGCCCAGTTGGG + Intergenic
1026679909 7:72457988-72458010 TCAAGCCATCTTCCCCACCTTGG + Intergenic
1028674830 7:93447007-93447029 GAAAGCCATATTATCCACTTTGG + Intronic
1029693701 7:102199486-102199508 AGAATCCATCCTCCCCACTTAGG + Intronic
1030045927 7:105495518-105495540 TCAAGCCATCTTGCCCGCCTTGG - Intronic
1030173476 7:106627882-106627904 AACAGCCATCCTGCCCAAGTAGG - Intergenic
1030305421 7:108013517-108013539 AGAAAGCATCATGCCCACTTTGG + Intergenic
1030716975 7:112819669-112819691 AAAATACATCATGCACACTTTGG + Exonic
1037018041 8:13932902-13932924 CAAAACCTTCTTGGCCACTTGGG - Intergenic
1038039064 8:23708808-23708830 AAAAGTCATCATGCGCACCTTGG + Intergenic
1038914292 8:32002917-32002939 AGAAGCCATGTTTCTCACTTTGG - Intronic
1038977844 8:32721079-32721101 GAAAGGAATCTTACCCACTTAGG + Intronic
1039630319 8:39105127-39105149 AAAAGCCATTGTGCACACTTTGG - Intronic
1039790722 8:40873553-40873575 AGAAGCCATCTTGCCTAGTAAGG - Intronic
1042692453 8:71516495-71516517 AAAAGCCATATTTTCCTCTTTGG - Intronic
1042844336 8:73155300-73155322 AGAAGACTTCTTGGCCACTTGGG + Intergenic
1046663889 8:116978013-116978035 CAGAGCTATCTTGCCAACTTTGG + Intronic
1047388219 8:124429068-124429090 AAAAGCAATCTTAGCTACTTGGG + Intergenic
1049901115 9:166252-166274 AAAAGCCACATTGCCCCATTTGG + Intronic
1053117601 9:35519358-35519380 AAAACCTATCCTGCCAACTTGGG + Intronic
1053744153 9:41176567-41176589 AAAAGCCACATTGCCCCATTTGG + Intronic
1054349429 9:64006370-64006392 AAAAGCCACATTGCCCCATTTGG + Intergenic
1054483120 9:65688730-65688752 AAAAGCCACATTGCCCCATTTGG - Intronic
1054684190 9:68254686-68254708 AAAAGCCACATTGCCCCATTTGG - Intronic
1056130110 9:83576214-83576236 AAAACCAATCTTGCCCTCCTGGG - Intergenic
1058565848 9:106284340-106284362 CAAAGACATCTTGCCCTATTTGG + Intergenic
1059172356 9:112137787-112137809 AAATTCCATCATGCTCACTTTGG + Intronic
1186859225 X:13654812-13654834 AAAAACCATGGTGCCCACTGTGG - Intronic
1188925974 X:36044166-36044188 AAAAGCCATTTTTCCCTCCTAGG + Intronic
1189895050 X:45646729-45646751 AGAAGCCATCTTGGACAATTAGG - Intergenic
1198629892 X:138624643-138624665 TCAAGCCATCTTGCCCACCTTGG - Intergenic