ID: 1099078688

View in Genome Browser
Species Human (GRCh38)
Location 12:78146498-78146520
Sequence TCCACAGGACTGCTGAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099078686_1099078688 10 Left 1099078686 12:78146465-78146487 CCACTAGAGGGCTCTGTGATACA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1099078688 12:78146498-78146520 TCCACAGGACTGCTGAAGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099078688 Original CRISPR TCCACAGGACTGCTGAAGTA AGG Intronic
902133096 1:14280709-14280731 TTCCCAGGACTGCTGTAATAAGG - Intergenic
903434138 1:23333573-23333595 ACCACAGGACAGAGGAAGTATGG - Exonic
904430764 1:30462630-30462652 TGCACAGGACTGCTGGAGCTTGG + Intergenic
905848751 1:41257560-41257582 TCCATAGGGCTGCTGCAGTATGG + Intergenic
911769307 1:101719107-101719129 TCCATAGGACTGTTGACTTATGG + Intergenic
916413661 1:164573012-164573034 TCCACAGAACTCTAGAAGTAGGG - Intronic
918950199 1:191126425-191126447 TCCACAGGGCTGCTCTAGGAAGG + Intergenic
919426549 1:197439498-197439520 TCCACACGTTTGCTGCAGTAAGG + Intronic
1063054991 10:2495234-2495256 TCCACAGGAAAACTGAAGCAGGG - Intergenic
1065034724 10:21626000-21626022 ACCACAGGACAGAGGAAGTATGG - Intronic
1070799431 10:79236468-79236490 ACCCCAGGACTGCTGAGGCACGG + Intronic
1074961682 10:118451497-118451519 TCCAGAGGGCTGCTGTAGTCTGG + Intergenic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1076255591 10:129022018-129022040 TCCAGAGGAATGCAGAAGTTTGG - Intergenic
1081652744 11:44835200-44835222 CCGACAGCACTGCTGGAGTATGG + Intronic
1081740650 11:45437473-45437495 TGCTCAGGACTGCTCAAGTGTGG - Intergenic
1082189465 11:49225292-49225314 TCCAGAGGACTGCTGACGTGAGG + Intergenic
1084744188 11:71157439-71157461 TCCACATGAATGCTGAGGCATGG - Intronic
1086677061 11:89621212-89621234 CCCAGAGGACTGCTGACGTGAGG - Intergenic
1094747061 12:33357206-33357228 TCCCCAGGGCTGCTGAAGTCTGG - Intergenic
1096992862 12:55819120-55819142 ACAACAGGAATGCTGAAGAAGGG - Exonic
1099078688 12:78146498-78146520 TCCACAGGACTGCTGAAGTAAGG + Intronic
1102199027 12:111044736-111044758 TCCACAGGAGGGATGAGGTAGGG + Intronic
1102202838 12:111069395-111069417 TCCACTGGACAGACGAAGTATGG - Intronic
1106506133 13:30371962-30371984 TCAACAGGAATGCTGCAGTTGGG + Intergenic
1107371507 13:39755264-39755286 TCAACACTACTGCTGAACTAGGG - Intronic
1107866790 13:44710826-44710848 TCCACAGGACTCCTGACTCATGG + Intergenic
1111627296 13:90805537-90805559 TCAACAGGAGTGCTAAATTAGGG + Intergenic
1111795260 13:92910994-92911016 TTCAAAGAACTGCTGAAGTGTGG - Intergenic
1112475670 13:99729321-99729343 TCTAAAGGGCTGCTGAAGGAAGG - Intronic
1112882855 13:104130800-104130822 ATCACTGGACTTCTGAAGTATGG - Intergenic
1113216647 13:108048658-108048680 TCCTCAGGGCTGCTGTAGCACGG + Intergenic
1116409715 14:44607134-44607156 GCCACAGGGCTGCTGAGCTATGG - Intergenic
1118639241 14:67777106-67777128 TCCAAAGGGCTTCTGATGTAAGG - Intronic
1122022040 14:98846170-98846192 TCCCAAGGACTGCTGCTGTAAGG - Intergenic
1128705148 15:69832743-69832765 AGCACAGGAATCCTGAAGTAAGG + Intergenic
1131164266 15:90130872-90130894 TCCCCAGAACTGCAAAAGTAGGG - Intergenic
1133444595 16:5849267-5849289 TCCACATGACTGCTAAAATCAGG - Intergenic
1134908041 16:17998908-17998930 TCCACAGATATGCTGAAGGAAGG - Intergenic
1140562472 16:75999275-75999297 TCCACAGATTTGCTGAAGTCAGG - Intergenic
1140623932 16:76769739-76769761 TCCACAGGGTTGCTGGAGTAGGG + Intergenic
1142211189 16:88809395-88809417 CCCACAGTACAGCTGAAGTCTGG + Exonic
1148172315 17:45532694-45532716 GCCACATGACTGGTTAAGTATGG + Intergenic
1148299068 17:46530342-46530364 GCCACATGACTGGTTAAGTATGG - Intronic
1148363605 17:47034870-47034892 GCCACATGACTGGTTAAGTATGG - Intronic
1148464114 17:47854670-47854692 TCTACAGGACAGTTGAAGTTTGG - Intronic
1149329177 17:55564031-55564053 TACACAGGATTGCTGATTTAGGG + Intergenic
1150403521 17:64879610-64879632 GCCACATGACTGGTTAAGTATGG + Intronic
1151194502 17:72421952-72421974 CCCACCTGACTCCTGAAGTAGGG - Intergenic
1154212600 18:12392838-12392860 TACATAGAATTGCTGAAGTAAGG - Intergenic
1156486629 18:37470448-37470470 TCCCCAGGTCTTCTGAATTAGGG + Intronic
1157856065 18:51106869-51106891 ACCACAGGATTGCTCAAGGAGGG - Intergenic
1158926957 18:62275428-62275450 ACCTCACGAGTGCTGAAGTATGG - Exonic
1159279506 18:66267648-66267670 GCCACAGGACTGGTTGAGTAAGG - Intergenic
1160320270 18:77884798-77884820 TCCAGGCGACTGCTGAAGAAGGG - Intergenic
1160613701 18:80108726-80108748 CCCACAGGAATGATGAAGTCAGG + Intergenic
1165218811 19:34297654-34297676 TCTACAGGAATGCTGAAGCGGGG - Intronic
1168007775 19:53505199-53505221 TCCACAGACCTGCTGTAGTGCGG - Intergenic
925445974 2:3927280-3927302 CTCACAGGACTGCTGACGTCTGG + Intergenic
926726059 2:15998936-15998958 CCCACGGGGCTGCTGAAGAAGGG - Intergenic
932209886 2:69918443-69918465 TCCATAGAACTGCTGGAATATGG + Intronic
932306587 2:70707941-70707963 CCAACAGGACTGCTGGAGCAAGG - Intronic
932438698 2:71718213-71718235 GCCACAGGACTGCTGGGGTTTGG - Intergenic
935876264 2:107511501-107511523 TCCCCTGGACTGCTGAACTGTGG + Intergenic
937026403 2:118701562-118701584 TCCACTGCACTGCTGGAGAAGGG + Intergenic
938498595 2:131817999-131818021 TCCACAGGGGTGCTGCTGTAGGG - Intergenic
939153543 2:138500045-138500067 TCAACAGGATTGCTAACGTAAGG + Intergenic
939186646 2:138868971-138868993 TCCACATCACAGCTGAAGAAGGG - Intergenic
945372817 2:209041220-209041242 GAGGCAGGACTGCTGAAGTATGG - Intergenic
947387406 2:229605310-229605332 TCCACAGAGCTGCAGAATTAAGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1173764690 20:45596705-45596727 TCCACAGTACTGCAGATGGAGGG + Intergenic
1177370520 21:20197558-20197580 TACAGAGCACTGCTGAAGGAGGG + Intergenic
1177586535 21:23102821-23102843 ACCTCAGGACTGCTGAGGTCAGG + Intergenic
1177631786 21:23738274-23738296 GCCACATGACTCCTGAAGAAGGG - Intergenic
1180968033 22:19800692-19800714 TCCCCAGGACAGCTGACGGATGG + Intronic
951955856 3:28252647-28252669 TCCACAGTTATGCTGAAGCAGGG - Intronic
953097384 3:39792039-39792061 TTCAGAGGACACCTGAAGTAAGG - Intergenic
960253675 3:115487073-115487095 TCTCCAGGACTGCTGACGAAGGG - Intergenic
960442098 3:117701661-117701683 TCCCTATGACTGCTAAAGTAAGG + Intergenic
961026075 3:123558918-123558940 ACCAAAGAACTGCTGAAATATGG + Intronic
963157749 3:142117462-142117484 TCCACAGGCTTGCAGAGGTAAGG - Intronic
964762669 3:160149027-160149049 TCACCTGGACTGCTGATGTATGG + Intergenic
966030388 3:175339116-175339138 TCCTCAAGTCTGCTGAAGAATGG - Intronic
968857917 4:3142074-3142096 TCAAGAGGCCTGCTGAAGTTTGG - Intronic
971327547 4:25656504-25656526 TCCCCAAGACGGCTGAAGGACGG - Intronic
975082250 4:70295615-70295637 TCTACAGCTCTGCTGAAGCAGGG - Intergenic
976549731 4:86380350-86380372 TCCAGAGGAGTGCTGATGTCAGG - Intronic
977294621 4:95197317-95197339 TCCACAGAAATGCTGGACTAGGG - Intronic
979965323 4:127069917-127069939 TACACAGGACTTCTGAATCATGG - Intergenic
981799047 4:148635060-148635082 CCCACAGAACTGCTGAAGAAAGG - Intergenic
984712039 4:182893833-182893855 TCCACAGGACTGGTGATAAACGG + Intronic
989192283 5:38682935-38682957 TCCCCAGGAATGCTGGAGGAGGG - Intergenic
995538556 5:113161959-113161981 ACCACAGGGCTGCTGACGGATGG + Intronic
996507388 5:124283332-124283354 TCAACAAGACTGATGGAGTAAGG + Intergenic
996909986 5:128645443-128645465 ACCACAGCTCTGCTGAAGGATGG - Intronic
1001436392 5:171702808-171702830 TCCACAGCAGTCCTGAAGAAAGG - Intergenic
1001897041 5:175391424-175391446 TCCTCAGCACTGCTGGACTAGGG + Intergenic
1006079428 6:31556691-31556713 TCCAAATGACTGCTGACCTAGGG - Intronic
1006781311 6:36634276-36634298 TCCACAGGATTCCTGAAAAAGGG + Intergenic
1009964533 6:70564796-70564818 TCCACAGGACAAATGAACTAAGG - Intergenic
1010744475 6:79545282-79545304 ACAAAAGGACAGCTGAAGTACGG - Intergenic
1011553373 6:88549742-88549764 TCCACATAACTGCTGAAGAATGG - Intergenic
1015955183 6:138590982-138591004 TACACAGGCCTGCTGAAATCAGG - Intronic
1018144993 6:160877424-160877446 TCCACAGGACAGGTCCAGTAAGG + Intergenic
1018729554 6:166638246-166638268 TCCACAAGACCGCTGAAGTCAGG + Intronic
1026843005 7:73681376-73681398 TACACAGGACTACTGAGGGACGG - Exonic
1035617447 8:1012695-1012717 TCCACACTGCCGCTGAAGTAGGG - Intergenic
1039604597 8:38870237-38870259 TCCACAGGCCTGCTTAAGCTTGG - Intergenic
1040375557 8:46821529-46821551 CCCACAGGACTGCTGAATCGTGG - Intergenic
1040567198 8:48578069-48578091 TCCATAGAATTGCTGAAGAATGG - Intergenic
1042766806 8:72331085-72331107 TCCACAGGACTGTTGGACCAAGG + Intergenic
1044379089 8:91512288-91512310 CTGACATGACTGCTGAAGTAGGG + Intergenic
1047355052 8:124112397-124112419 TCCACGGGATTGCTGAGGAATGG + Intronic
1048983351 8:139715255-139715277 TCCCCAGGACTGCTGGTGTGTGG - Intergenic
1054894420 9:70292167-70292189 TCATCAGGAATGGTGAAGTAAGG - Intronic
1055453584 9:76453177-76453199 TTCACAGCACTGGTGAAGCAGGG - Intronic
1057583396 9:96307721-96307743 TCCACAGGACAGCTGGAGCTGGG - Intergenic
1058744326 9:107975110-107975132 TCCACAGGCCTGGGGAAGAATGG - Intergenic
1060434722 9:123583614-123583636 TCCCCAGGAATGCTGATATACGG + Intronic
1203745451 Un_GL000218v1:38578-38600 TCCACAGCACAGCTCAAGTGTGG - Intergenic
1203564659 Un_KI270744v1:80906-80928 TCCACAGCACAGCTCAAGTGTGG + Intergenic
1186887095 X:13924693-13924715 TCCACAGGAGTCCTGAAGATGGG - Intronic
1189758717 X:44299053-44299075 TCCACAGGACTGTTAAACTAAGG + Intronic
1189880555 X:45487120-45487142 TCCACAGGACTCATGCAGGAGGG + Intergenic
1190232230 X:48591038-48591060 TTCACAAGACTGCTGTTGTAAGG + Intronic
1190321117 X:49179745-49179767 TCCCCAGGACTGTTGACGTAGGG + Exonic
1193028719 X:76874856-76874878 TCCATAGTACTGCTGTGGTATGG - Intergenic
1193714939 X:84926985-84927007 TCCATAGGGCTGCTGTGGTATGG + Intergenic
1194624882 X:96215405-96215427 GCCACAGGTCTGCTGGAGTTTGG - Intergenic
1197569351 X:128130322-128130344 TACACAGAACTTCTGAAGGATGG + Intergenic
1199461770 X:148093474-148093496 TCCACAGGGCTGGTCAGGTAAGG - Intergenic
1201158772 Y:11153589-11153611 TCCACAGCACAGCTCAAGTGTGG - Intergenic