ID: 1099079722

View in Genome Browser
Species Human (GRCh38)
Location 12:78161739-78161761
Sequence CTGTATACACACAACAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099079721_1099079722 28 Left 1099079721 12:78161688-78161710 CCTTATCACTTTTTTAACTGAAA 0: 1
1: 0
2: 3
3: 46
4: 498
Right 1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG 0: 1
1: 0
2: 0
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099079722 Original CRISPR CTGTATACACACAACAATCA TGG Intronic
901644113 1:10707483-10707505 CTGATCACACAGAACAATCAGGG + Intronic
905097204 1:35483608-35483630 CTGTATAGCCACAGTAATCAAGG - Intronic
909743291 1:79060209-79060231 CTGTATACCAACAATACTCAAGG + Intergenic
911833863 1:102590464-102590486 CAGAACACACACAACAATTATGG + Intergenic
915803760 1:158822500-158822522 CTGTATACCAACAACAACCAAGG - Intergenic
916846794 1:168659407-168659429 CATAATACACACAACAATTAAGG - Intergenic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
918254804 1:182739661-182739683 CTGTCTACATACACAAATCAGGG - Intergenic
921100266 1:211922756-211922778 CTGTGAAAACACAACAATCCAGG + Intergenic
923090052 1:230733598-230733620 CTGTTTTCACACAATAAGCAAGG - Intergenic
924672291 1:246141269-246141291 CTGTATACACACAACAGAACTGG + Intronic
1064142047 10:12798843-12798865 CTGTGCACACAGAAGAATCAGGG + Intronic
1064489358 10:15834820-15834842 CTCTATATAAACAACACTCATGG + Intronic
1067077165 10:43194510-43194532 CTGTACACACACAGCAGGCAAGG + Intergenic
1071971170 10:90908649-90908671 CAGAACACACACAACATTCATGG - Intergenic
1074646395 10:115457743-115457765 CTGAATATACACAACATGCAGGG - Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1082270521 11:50164843-50164865 CTGTATAAAAACAATAATAATGG - Intergenic
1086055757 11:82644181-82644203 CTGAATAAACACATCATTCAAGG + Intergenic
1086668069 11:89509762-89509784 CTTATAACACACAACAATCAGGG + Intergenic
1087879347 11:103396758-103396780 CTGTATACACACACACAGCATGG + Intronic
1087928257 11:103945719-103945741 CTGTGTACACACTACATTCTAGG - Intronic
1088063264 11:105683138-105683160 ATGTATACAGAGAAAAATCATGG - Intronic
1090680069 11:129046108-129046130 CCGTATACACACTCCCATCATGG + Intronic
1091061940 11:132471800-132471822 CTAAATACACTCAACAATCTAGG + Intronic
1093958527 12:25249849-25249871 CTGTCTACACTCAACTAGCAAGG + Intronic
1095034680 12:37346771-37346793 CTGAATACACACAACACAAAAGG + Intergenic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1107366452 13:39683525-39683547 ATGTATATGCACAACATTCAGGG - Intronic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1109628331 13:65009063-65009085 CTGTAAATACACAACCATTAAGG - Intergenic
1109646008 13:65257593-65257615 CTGTTTACATACTAAAATCAGGG - Intergenic
1112304089 13:98257796-98257818 CTGTAGCCACACATCAATGAGGG - Intronic
1112407907 13:99137086-99137108 CTGTATACACACAGGAGTGAAGG + Intergenic
1113863031 13:113502657-113502679 CTGTCTCCCCACAACACTCACGG + Intronic
1118158072 14:63260742-63260764 ATTTACACACTCAACAATCAGGG - Intronic
1125251456 15:37709878-37709900 CAGTGTACACACCACAATAATGG - Intergenic
1131727959 15:95247737-95247759 CTGTAAAAACTCATCAATCAGGG - Intergenic
1135279646 16:21142898-21142920 CTCAATAAACACAACAATCAAGG + Intronic
1139119067 16:63993420-63993442 ATTTATACACACAACAAGGATGG + Intergenic
1139186828 16:64816205-64816227 CTGTACACTAACAACAGTCAAGG - Intergenic
1140210564 16:72966650-72966672 CTGAACACACACACCATTCACGG + Intronic
1144017416 17:11209145-11209167 CTGTAAAAACACATCAATCGGGG - Intergenic
1149379638 17:56080745-56080767 GTGTATACATACAAAAATAAGGG - Intergenic
1150177366 17:63073751-63073773 GTGTAAACCCACAAAAATCAGGG + Intronic
1155996481 18:32336095-32336117 CTGTAAACAAACAATAATTAAGG + Intronic
1156998001 18:43492030-43492052 ATGTAAACATACAACAATGAAGG - Intergenic
1158762518 18:60407071-60407093 CTGTACACCAACAACATTCAAGG + Intergenic
1159031791 18:63239208-63239230 CTTTATACTCATAACAATAAAGG - Intronic
1162660043 19:12161695-12161717 CTCTATACATAGAAAAATCAAGG - Intergenic
1166569002 19:43781696-43781718 GTGTAGACACACAACATTTAGGG + Intergenic
1166604180 19:44126292-44126314 CAGAATAGAGACAACAATCACGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926397915 2:12464688-12464710 CTGTATTCATTCAACAATTATGG - Intergenic
926613183 2:14968333-14968355 ATGTATACAAATAACAATAAGGG + Intergenic
927013850 2:18934991-18935013 ATGTTTACACACAACAATGGAGG - Intergenic
930353463 2:50287980-50288002 ATGTATAGACACAACAAAGAGGG + Intronic
930583503 2:53242253-53242275 CTGTATACACACCATAAACTTGG - Intergenic
930592293 2:53342302-53342324 CTGTACACCAACAACAGTCAAGG - Intergenic
930871564 2:56176151-56176173 CTGTATGCACACAAGAATATGGG + Intergenic
938398330 2:130966725-130966747 CTGTTTTCATTCAACAATCATGG + Intronic
938598905 2:132817499-132817521 CTTTATACACAAAAACATCAGGG - Intronic
938809303 2:134837562-134837584 GGGTAAACACAGAACAATCAAGG + Intergenic
939059256 2:137400309-137400331 ATGCAAACACACAAAAATCATGG - Intronic
945601233 2:211867257-211867279 CTGTATAAAAACAACAGTCCAGG + Intronic
946060926 2:216940998-216941020 CTGTTCACACACAGCAATAAAGG + Intergenic
1169941239 20:10939858-10939880 CTATATACACCCTAGAATCAAGG - Intergenic
1173024660 20:39296674-39296696 CTGCATACAAAGAATAATCATGG + Intergenic
1175360287 20:58404804-58404826 CAGAATACACAGAACAATCTTGG - Intronic
1177718056 21:24866195-24866217 CTGTATTGACAAAAAAATCATGG - Intergenic
1178521456 21:33291130-33291152 CTTTATACAGACACCAGTCACGG + Intronic
1182771629 22:32801047-32801069 CTGTATTCATTCAACAAACACGG - Intronic
949459842 3:4279316-4279338 ATGTAGAAACAAAACAATCAAGG + Intronic
954552162 3:51491018-51491040 CTGAATAGGCACAACAATCTTGG + Intronic
955899027 3:63732496-63732518 GTGTATAGGCACAACACTCAAGG + Intergenic
955922295 3:63970243-63970265 ATGCATACACACAACACTTAGGG - Intronic
956074017 3:65485454-65485476 CAGTATAAAGACAAAAATCATGG + Intronic
956666646 3:71648742-71648764 GTGTATACAAATAAGAATCATGG + Intergenic
959487134 3:106939883-106939905 CAATATACCCACAACAATCCTGG + Intergenic
964009019 3:151867177-151867199 GTGTATACACACAGCTGTCAGGG + Intergenic
964301527 3:155291391-155291413 CTGTATACACTAAACACACACGG - Intergenic
965014175 3:163135073-163135095 CTGAACACACACATAAATCATGG + Intergenic
965294054 3:166920434-166920456 CTGTCTAAAGACATCAATCATGG - Intergenic
965937535 3:174133110-174133132 GTGTTTTCACACAAAAATCAAGG - Intronic
966048896 3:175588986-175589008 ATGTATACACACACCATTTATGG - Intronic
966578081 3:181525949-181525971 GTCTATTCACACAACAGTCAAGG + Intergenic
967159214 3:186720375-186720397 TTGTATAGACAGAAAAATCATGG + Intronic
971626238 4:28923653-28923675 GTGTATACACAAAACACTCAGGG - Intergenic
975330228 4:73104589-73104611 CTGTATAGACAGAAAAATCCTGG + Intronic
978495961 4:109359240-109359262 CCTTAGCCACACAACAATCATGG + Intergenic
979604886 4:122627144-122627166 CTATATACATAGAACAATAAAGG + Intergenic
982961203 4:161839352-161839374 CTGTATAGACACAACAGATAAGG + Intronic
984596495 4:181674694-181674716 CTGTCTACTCAGAACAATCCTGG - Intergenic
986120282 5:4829095-4829117 CTGTATACTCACATCAATGAGGG + Intergenic
986764268 5:10909878-10909900 ATGTATACACACAAAATTCAGGG + Intergenic
989258831 5:39396534-39396556 GTGTATACACATAACAAGCAAGG - Intronic
990629594 5:57653215-57653237 CTGTATTTACACAATAATCATGG - Intergenic
991120606 5:63008700-63008722 GTTTATAAACACACCAATCAGGG + Intergenic
993356078 5:86909469-86909491 CTCTATATACACATCAATCATGG + Intergenic
994156791 5:96513014-96513036 CTGAAACCACAGAACAATCATGG + Intergenic
994611073 5:102040356-102040378 CTCTATACACACAAGGATGATGG + Intergenic
996001934 5:118374855-118374877 GTGAATAATCACAACAATCATGG - Intergenic
996172286 5:120308921-120308943 CTTTATTCACACCACAATCAAGG - Intergenic
997194628 5:131970364-131970386 CTGAACACAGACAACAAGCATGG + Intronic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
1001697238 5:173680176-173680198 CTGTAAAAACGCACCAATCAGGG - Intergenic
1003297771 6:4848527-4848549 CTGTAGAAAAACAACAATGAAGG + Intronic
1008807329 6:55446735-55446757 ATGAATACATACAACAATAAAGG + Intronic
1009483172 6:64186209-64186231 CTGTATACCCACAATCATCTAGG - Intronic
1010011978 6:71058492-71058514 CAGAATACACATAAAAATCATGG + Intergenic
1010720188 6:79274633-79274655 CTGACTACACACAACAATTGAGG - Intergenic
1010992198 6:82492160-82492182 CTCTATACACACAATTAGCAGGG - Intergenic
1011507741 6:88067027-88067049 CTGTATACCAAGAACAATGAAGG - Intergenic
1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG + Intronic
1013855755 6:114570178-114570200 CTGTAAACACACAGCATTGAGGG - Intergenic
1014467312 6:121772446-121772468 CTGAATCCACACAACTATCCTGG + Intergenic
1016116805 6:140296648-140296670 CTGTATACATATAAATATCAAGG - Intergenic
1017125360 6:151059475-151059497 TTTTATAAAAACAACAATCATGG - Intronic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1019906929 7:4071879-4071901 CTGTGTACACACATCTACCAAGG - Intronic
1019933163 7:4236909-4236931 CTGTCTCCACAAAACAAGCAAGG - Intronic
1020585320 7:10058745-10058767 TTGTGTACCCAAAACAATCAAGG + Intergenic
1022643572 7:32210296-32210318 ATGTATACATACAACAACCAAGG - Intronic
1023783680 7:43683954-43683976 CTGAAAAGACACAACAATTAGGG + Intronic
1023935139 7:44734314-44734336 CTGTAAAAACAAAACAAACAAGG - Intergenic
1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG + Intergenic
1032519698 7:132534521-132534543 CTATGCACACACAACACTCACGG - Intronic
1035986444 8:4437745-4437767 CTGTCTTCACACCACAAACATGG - Intronic
1037180891 8:16004598-16004620 GTGCATACCCACAAAAATCATGG + Intergenic
1039545678 8:38409458-38409480 CTGTGCACATACAGCAATCATGG + Intronic
1042046158 8:64654364-64654386 CTGTATACCAACAACAGCCAAGG + Intronic
1042393328 8:68261496-68261518 AAGTAAACACACAGCAATCAAGG - Intergenic
1046028105 8:108749448-108749470 CTGTACACCAACAACAGTCAAGG - Intronic
1046701203 8:117403067-117403089 CTGTTTAGACAGAACAATGAAGG + Intergenic
1048428731 8:134347504-134347526 TTTAATACACACAACATTCATGG + Intergenic
1054702393 9:68426304-68426326 CTGGATACTCACAATAATCCTGG - Intronic
1058157057 9:101527839-101527861 CTGTATACACACAGCAAGGAGGG - Intronic
1058549744 9:106101964-106101986 CTGTATATACACAACAAAAAAGG + Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1062575263 9:137203844-137203866 CTGTATGAAGACAACAATCTGGG - Intronic
1185916386 X:4040249-4040271 CAGTAAACACACAGCAATAAGGG + Intergenic
1191961176 X:66703732-66703754 CTGAATACACAAAGCAATCTTGG + Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1196615801 X:117766096-117766118 CGGTATACAAATAATAATCACGG + Intergenic
1197481965 X:126997281-126997303 TAGTTTACATACAACAATCACGG - Intergenic
1199087833 X:143649452-143649474 GTGTACACACACAAAAATCAAGG + Intergenic
1202372944 Y:24210533-24210555 GGGTATACACATAACAACCAGGG + Intergenic
1202497838 Y:25459587-25459609 GGGTATACACATAACAACCAGGG - Intergenic