ID: 1099080965

View in Genome Browser
Species Human (GRCh38)
Location 12:78179916-78179938
Sequence CTGTACTAGTAATTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099080965 Original CRISPR CTGTACTAGTAATTGGATTC AGG Intronic
913352914 1:117881923-117881945 CTATAATAGTAATTGGTTTTAGG - Intronic
919130129 1:193440835-193440857 CAGTAGGAGTAATTGGATCCTGG + Intergenic
921644161 1:217593561-217593583 CTGTAGCAGGAATTGGATTTAGG - Intronic
922028646 1:221777552-221777574 CAGTACTAGTAATTGTACTCTGG + Intergenic
922086808 1:222357089-222357111 CTGTACTATAATTTGAATTCAGG - Intergenic
922311978 1:224402796-224402818 CTGTATTTGTGATTGGGTTCAGG - Intronic
924399938 1:243668375-243668397 CTGTACTCCTAATTGCATTTGGG - Intronic
1066187759 10:33027002-33027024 CTGTACTTTTATTTGCATTCTGG + Intergenic
1068392934 10:56422852-56422874 CTGTGGAAGTAACTGGATTCTGG + Intergenic
1076077621 10:127548273-127548295 CTGCATTAATAAATGGATTCAGG - Intergenic
1079522994 11:21351003-21351025 TTATACCAGTAATTGGATTTAGG - Intronic
1084118367 11:67054976-67054998 CTGAACTAGAATTTGGATCCAGG - Intergenic
1084919774 11:72459596-72459618 CTGAACTAGTGATGGGATTGAGG + Intergenic
1087944285 11:104139481-104139503 CTGAACTAGAAATAGGCTTCTGG + Intronic
1090231004 11:125103565-125103587 CGGTACTTGTCATTGGATTTAGG + Intronic
1092093920 12:5826150-5826172 ATGTAATAGTATTTGGATTGGGG + Intronic
1098574657 12:72027627-72027649 GTCTACTAATAGTTGGATTCTGG + Intronic
1099080965 12:78179916-78179938 CTGTACTAGTAATTGGATTCAGG + Intronic
1099689992 12:85939737-85939759 ATGTAATAGTATTTGGATTGGGG + Intergenic
1102939325 12:116925207-116925229 ATGGACTAGTCATTGGATACAGG + Intronic
1105982877 13:25536734-25536756 CTGTACTAGTAATGGTCTTCTGG + Intronic
1108131393 13:47305070-47305092 CTCTACTGGTACTTGAATTCTGG + Intergenic
1111335722 13:86819812-86819834 CTGTGCTGGTAATTGGGTGCAGG - Intergenic
1116059178 14:39899099-39899121 ATGTAATAGTATTTGGATTGAGG + Intergenic
1117595981 14:57327676-57327698 ATGTAATAGTATTTGGATTGGGG - Intergenic
1118098064 14:62562220-62562242 CTGAAGTTGTAATTGGATCCAGG + Intergenic
1120797602 14:88652119-88652141 CTGTACAAGTACTTAGATTATGG + Intronic
1134319442 16:13149408-13149430 CTCTGCTGGTAAGTGGATTCAGG - Intronic
1134855804 16:17518045-17518067 CTGTACTTCTCCTTGGATTCTGG - Intergenic
1136411822 16:30082187-30082209 CTGTGTTAGTAACTTGATTCTGG + Intronic
1139339175 16:66256700-66256722 CTTTATTAATAATTGGATTTAGG + Intergenic
1144040900 17:11410468-11410490 CAGAACTAGTATTTGAATTCAGG + Intronic
1144250653 17:13413395-13413417 CTGTGCTGTTAATTGGCTTCTGG + Intergenic
1150100229 17:62416812-62416834 CTTTACTAGTAAATAGATGCTGG + Intergenic
1151109143 17:71654483-71654505 TTGTAATTGTAATTGGATTATGG - Intergenic
1153470578 18:5439920-5439942 CTAAACTATTCATTGGATTCAGG - Intronic
1154006118 18:10528571-10528593 CTGTACTGTTATTTGAATTCAGG - Intronic
1155638640 18:27985630-27985652 CTGTAATATTAATTGAATTGGGG + Exonic
1156666866 18:39419463-39419485 CTGTTTTAGTAGTTGGACTCAGG + Intergenic
1156830305 18:41483839-41483861 CTGTTCTAGTAATTACATTTGGG + Intergenic
1163812078 19:19439468-19439490 CTGTTCTAGTGATGGGAGTCAGG + Intronic
1166868199 19:45853894-45853916 CTGAACTAGTAATTGAATCCTGG - Intronic
1167872179 19:52379846-52379868 CTATACTGGTAATTTGATTTTGG + Intronic
927064055 2:19452036-19452058 CTGTACTGGTACTTTTATTCTGG + Intergenic
930566246 2:53024053-53024075 CTGTCCTAATAACTGGAATCGGG + Intergenic
938553201 2:132399633-132399655 CTCTACCAGTCATTGGATCCAGG + Intergenic
938820600 2:134954544-134954566 CTGTACTCGTGATTGGCATCAGG - Exonic
940471804 2:154110923-154110945 ATGTAATAGTATTTGGGTTCCGG - Intronic
942758920 2:179374910-179374932 CTGGACTACTAACTGGAGTCAGG + Intergenic
944115361 2:196180077-196180099 TTGTACCAGTAATTTGATGCAGG + Intergenic
946580586 2:221124424-221124446 CTGTTCTTGGAATTGGATTTTGG - Intergenic
948015117 2:234682793-234682815 CTGCACAAGGAATGGGATTCTGG + Intergenic
1172091015 20:32432841-32432863 CTCTTCTAGTAAGTGCATTCGGG - Intronic
1177970477 21:27783458-27783480 CTGTAGTAGAATTTGGAGTCAGG - Intergenic
1183852054 22:40598532-40598554 TTGTACTAGTAATCAGATTCTGG - Intronic
949639192 3:6015716-6015738 ATGTAATAGTATTTGGATTGGGG + Intergenic
951384806 3:22029717-22029739 CTGTAATAGTATTTGGGTTGGGG + Intronic
956071651 3:65459206-65459228 CTGTACTATTATTTGAAGTCAGG + Intronic
957333372 3:78794894-78794916 CTTTACCAGTAATTGCATTCTGG + Intronic
963536519 3:146536392-146536414 CTGAACTAGACATTGTATTCTGG + Intronic
967725958 3:192862678-192862700 GTGTATGAGTCATTGGATTCAGG - Intronic
971990018 4:33880594-33880616 ATCGGCTAGTAATTGGATTCAGG + Intergenic
972556373 4:40185183-40185205 CTGTAGAAGTAAATTGATTCAGG + Intergenic
973866644 4:55120807-55120829 CTGTACTGGTTATTGGAATGTGG + Intronic
980655099 4:135772356-135772378 ATGTAATAGTATTTGTATTCTGG + Intergenic
980685951 4:136228668-136228690 CTGAATTAATCATTGGATTCTGG + Intergenic
981463091 4:145033983-145034005 ATGTACTAGTATTTGGGTTGGGG + Intronic
984744145 4:183197223-183197245 CTGTAATGGTAATGGTATTCTGG + Intronic
987967113 5:24891638-24891660 CGGTAGTGGTAATTGGATCCTGG + Intergenic
988056490 5:26104437-26104459 ATGTAATAGTATTTGGATTGGGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
994313513 5:98304894-98304916 CTGTGCTAGGAATTGCATACAGG - Intergenic
995657310 5:114441349-114441371 CTTTACTAGTTATTGGCTACAGG - Intronic
1001187963 5:169595287-169595309 CTGAGGTAGTAATTGGAATCTGG + Intronic
1004196977 6:13514039-13514061 CTACTCTAGCAATTGGATTCTGG + Intergenic
1005045278 6:21635988-21636010 CTGTAGTAGTGATTGGGGTCTGG + Intergenic
1005818359 6:29575989-29576011 CTGCACTAGAAAATGGATGCAGG - Intronic
1005899294 6:30204023-30204045 CTGAACAAGTGAATGGATTCAGG + Intronic
1007230053 6:40341938-40341960 CTGGACTTGTGATTGGAGTCTGG + Intergenic
1009529312 6:64789833-64789855 TTGTAGTAGTCATTGGATGCTGG - Intronic
1013064223 6:106668194-106668216 CTGCACTAATAATTTGAATCTGG + Exonic
1013671734 6:112410856-112410878 CTGTACTAATAATTTGATTCAGG + Intergenic
1014417278 6:121197609-121197631 ATGTAATAGTATTTGGGTTCAGG + Intronic
1018876951 6:167829291-167829313 CTGTACTATTAAATTTATTCTGG + Intronic
1021294089 7:18882345-18882367 CTTTAATAGGAATTGTATTCAGG + Intronic
1023540708 7:41262439-41262461 ATGTACCAGAAATTGGATGCAGG + Intergenic
1023959616 7:44915465-44915487 CTGTACCAGTAAATGGATTTGGG + Intergenic
1024784945 7:52896649-52896671 CTGTACTCGTAAGTGTTTTCAGG + Intergenic
1028212441 7:88091471-88091493 CAATACTAGTAACTGGATTTAGG + Intronic
1030931006 7:115523470-115523492 ATGTACTAGTATTTGGGTTGGGG - Intergenic
1031256248 7:119452375-119452397 CTGTACTATTAATGTGTTTCAGG + Intergenic
1032029362 7:128469667-128469689 CTTTACTAGTAAATAGATGCTGG + Intergenic
1037406734 8:18550387-18550409 CTGTATTATTAACTGGACTCAGG + Intronic
1038631177 8:29245705-29245727 CTGTACTAGGAATTCTAGTCAGG + Intronic
1042069757 8:64918566-64918588 CTTGGCTAGTAAATGGATTCAGG + Intergenic
1042316017 8:67426850-67426872 CTGTAACAAGAATTGGATTCAGG - Intronic
1043515777 8:80993442-80993464 CTGGACTTGAAATTGGACTCTGG + Intronic
1052161064 9:25260281-25260303 CTTTCCAAGTAATTGGATTGTGG - Intergenic
1056313958 9:85370733-85370755 CTGTAATAGTATTTGGGTTGAGG - Intergenic
1196386391 X:115158090-115158112 AAGTACTAGTAACTGGATTAGGG - Intronic
1196565389 X:117198227-117198249 CTGTAATAGTAATTGGGTATTGG + Intergenic
1197001722 X:121447814-121447836 TTGAAGAAGTAATTGGATTCTGG - Intergenic
1198176740 X:134163923-134163945 CTGTATGTGTCATTGGATTCAGG - Intergenic
1198575909 X:138010010-138010032 TTCTACTAGTACTTGAATTCTGG + Intergenic
1199568492 X:149243877-149243899 CTGTAATATTATTTGAATTCAGG + Intergenic
1201225671 Y:11816651-11816673 CTGTACTAGGAGTTGGATGTGGG - Intergenic